Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BltR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 1
Bacillus amyloliquefaciens FZB42 2 1
Bacillus pumilus SAFR-032 1 1
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125 1 1
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH4045
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -65
score = 5.85514
sequence = GACTATCGTGTTACACCACACCT

Gene: BH4045: MATE family multidrug export protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
MATE family multidrug export protein
 
CRON 2.
yrkN
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU26450: Possible acetyltransferase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024110: Possible acetyltransferase
*2
Bacillus pumilus SAFR-032

Site:
position = -32
score = 5.74334
sequence = GACTATGGAGTTACTCCACCCTT

Gene: BPUM_1819: Possible acetyltransferase

Gene: BPUM_2354: Possible acetyltransferase
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Possible acetyltransferase
 
CRON 3.
bltD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU26600: Spermine/spermidine acetyltransferase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -120
score = 6.38308
sequence = GACTATACGGTAACCATATCCTT

Gene: RBAM_006040: Spermine/spermidine acetyltransferase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1723: Spermine/spermidine acetyltransferase
 
Paenibacillus sp. JDR-2
Spermine/spermidine acetyltransferase
ydhB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU05690: Hypothetical secreted protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_006030: Hypothetical secreted protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_3167: Hypothetical secreted protein
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC3673: Hypothetical secreted protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2960: Hypothetical secreted protein
Hypothetical secreted protein
blt
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -104
score = 6.55373
sequence = GACTATACGGTAACCATATACCT

Gene: BSU26590: Multidrug resistance protein, major facilitator (MFS) superfamily
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_010750: Multidrug resistance protein, major facilitator (MFS) superfamily
 
Bacillus pumilus SAFR-032

Gene: BPUM_0475: Multidrug resistance protein, major facilitator (MFS) superfamily
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC0855: Multidrug resistance protein, major facilitator (MFS) superfamily
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1965: Multidrug resistance protein, major facilitator (MFS) superfamily
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5113: Multidrug resistance protein, major facilitator (MFS) superfamily
Multidrug resistance protein, major facilitator (MFS) superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD