Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SufR - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Synechococcus sp. PCC 7002 6 3
Synechocystis sp. PCC 6803 6 3
Cyanothece sp. ATCC 51142 6 4
Cyanothece sp. PCC 8801 6 3
Cyanothece sp. PCC 7425 10 2
Microcystis aeruginosa NIES-843 5 2
Nostoc sp. PCC 7120 5 2
Trichodesmium erythraeum IMS101 5 2
Synechococcus elongatus PCC 7942 6 2
Prochlorococcus marinus str. MIT 9313 5 2
Synechococcus sp. JA-3-3Ab 2 2
Synechococcus sp. WH 8102 6 2
Gloeobacter violaceus PCC 7421
Thermosynechococcus elongatus BP-1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sufB
*
Synechococcus sp. PCC 7002

Site:
position = -145
score = 5.24215
sequence = TTTGACAACTTTTTTGTTGTTAAA

Site:
position = -104
score = 5.56969
sequence = TAAAACAACCAAACAGTTGTTAAA

Gene: SYNPCC7002_A1814: Iron-sulfur assembly protein
*
Synechocystis sp. PCC 6803

Site:
position = -116
score = 5.31695
sequence = TAAAACAACTTACCTGTTGTTTTA

Gene: slr0074: Iron-sulfur assembly protein
*
Cyanothece sp. ATCC 51142

Site:
position = -155
score = 4.75697
sequence = TTTGACAACAATTGAGTTGTTAAT

Site:
position = -115
score = 5.83461
sequence = TAAAGAAACATAAATGTTGTTTTA

Gene: cce_0685: Iron-sulfur assembly protein
*
Cyanothece sp. PCC 8801

Site:
position = -188
score = 4.8096
sequence = TTTGACAACAATGGGGTTGTTATT

Site:
position = -148
score = 5.85691
sequence = TTGAGCAACAAAAATGTTGTTTAA

Gene: PCC8801_0415: Iron-sulfur assembly protein
*
Cyanothece sp. PCC 7425

Site:
position = -106
score = 5.00114
sequence = TTAGACAACTGATGTGTTGCTAAA

Site:
position = -67
score = 5.33647
sequence = TTAAGCAACGCCTGAGTTGTTTAA

Gene: Cyan7425_3450: Iron-sulfur assembly protein
*
Microcystis aeruginosa NIES-843

Site:
position = -105
score = 5.10361
sequence = TTTGACAACAGCTTTGTTGTTAAT

Site:
position = -65
score = 5.87571
sequence = TTAAACAACTTTATTGTTGTTTAA

Gene: MAE_23090: Iron-sulfur assembly protein
*
Nostoc sp. PCC 7120

Site:
position = -193
score = 5.17528
sequence = TTTGACAACATTGTTGTTGTTAAT

Site:
position = -148
score = 6.0379
sequence = TTAAACAACATCGATGTTGTTTTA

Gene: alr2492: Iron-sulfur assembly protein
*
Trichodesmium erythraeum IMS101

Site:
position = -62
score = 6.04928
sequence = TTAAACAACAAATAAGTTGTTTAA

Gene: Tery_4355: Iron-sulfur assembly protein
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1735: Iron-sulfur assembly protein
*
Prochlorococcus marinus str. MIT 9313

Site:
position = -194
score = 5.00624
sequence = AAACGAAACCAATAGGTTTCGTTT

Gene: PMT1606: Iron-sulfur assembly protein
*
Synechococcus sp. JA-3-3Ab

Site:
position = -67
score = 5.33468
sequence = TTAAGCAACAACCGTGTTGTTTTA

Gene: CYA_2190: Iron-sulfur assembly protein
 
Synechococcus sp. WH 8102

Gene: SYNW0319: Iron-sulfur assembly protein
 
Gloeobacter violaceus PCC 7421

Gene: gvip196: Iron-sulfur assembly protein
*
Thermosynechococcus elongatus BP-1

Site:
position = -116
score = 5.50114
sequence = TAAAACAACCGTTTTGTTGCTAAA

Site:
position = -78
score = 5.2042
sequence = TAAAGCAACCATCTCGTTGCTTAA

Gene: null: Iron-sulfur assembly protein
Iron-sulfur assembly protein
Cyan7425_3449
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3449: Hypothetical protein
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Hypothetical protein
Cyan7425_3448
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3448: Hypothetical protein
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Hypothetical protein
Cyan7425_3447
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3447: Hypothetical protein
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Hypothetical protein
Cyan7425_3446
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_F0040: Predicted oxoglutarate/iron-dependent oxygenase
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3446: Predicted oxoglutarate/iron-dependent oxygenase
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Predicted oxoglutarate/iron-dependent oxygenase
Cyan7425_3445
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0218: Conserved hypothetical protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3445: Conserved hypothetical protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_21360: Conserved hypothetical protein
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Conserved hypothetical protein
sufC
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A1813: Iron-sulfur assembly ATPase
 
Synechocystis sp. PCC 6803

Gene: slr0075: Iron-sulfur assembly ATPase
 
Cyanothece sp. ATCC 51142

Gene: cce_0686: Iron-sulfur assembly ATPase
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0416: Iron-sulfur assembly ATPase
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3444: Iron-sulfur assembly ATPase
 
Microcystis aeruginosa NIES-843

Gene: MAE_23080: Iron-sulfur assembly ATPase
 
Nostoc sp. PCC 7120

Gene: alr2493: Iron-sulfur assembly ATPase
 
Trichodesmium erythraeum IMS101

Gene: Tery_4356: Iron-sulfur assembly ATPase
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1736: Iron-sulfur assembly ATPase
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1605: Iron-sulfur assembly ATPase
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2193: Iron-sulfur assembly ATPase
 
Synechococcus sp. WH 8102

Gene: SYNW0320: Iron-sulfur assembly ATPase
 
Gloeobacter violaceus PCC 7421

Gene: glr1371: Iron-sulfur assembly ATPase
 
Thermosynechococcus elongatus BP-1

Gene: tlr1904: Iron-sulfur assembly ATPase
Iron-sulfur assembly ATPase
sufD
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A1812: Iron-sulfur assembly protein
 
Synechocystis sp. PCC 6803

Gene: slr0076: Iron-sulfur assembly protein
*
Cyanothece sp. ATCC 51142

Site:
position = -137
score = 5.81499
sequence = TTTAACAACATTTTTGTTGCTAAA

Gene: cce_1005: Iron-sulfur assembly protein
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0417: Iron-sulfur assembly protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3443: Iron-sulfur assembly protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_23070: Iron-sulfur assembly protein
 
Nostoc sp. PCC 7120

Gene: alr2494: Iron-sulfur assembly protein
 
Trichodesmium erythraeum IMS101

Gene: Tery_4357: Iron-sulfur assembly protein
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1737: Iron-sulfur assembly protein
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1604: Iron-sulfur assembly protein
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2194: Iron-sulfur assembly protein
 
Synechococcus sp. WH 8102

Gene: SYNW0321: Iron-sulfur assembly protein
 
Gloeobacter violaceus PCC 7421

Gene: glr1372: Iron-sulfur assembly protein
 
Thermosynechococcus elongatus BP-1

Gene: tlr1905: Iron-sulfur assembly protein
Iron-sulfur assembly protein
sufS
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A1811: Cysteine desulfurase (EC 2.8.1.7)
 
Synechocystis sp. PCC 6803

Gene: slr0077: Cysteine desulfurase (EC 2.8.1.7)
 
Cyanothece sp. ATCC 51142

Gene: cce_1004: Cysteine desulfurase (EC 2.8.1.7)
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0418: Cysteine desulfurase (EC 2.8.1.7)
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_3442: Cysteine desulfurase (EC 2.8.1.7)
 
Microcystis aeruginosa NIES-843

Gene: MAE_23060: Cysteine desulfurase (EC 2.8.1.7)
 
Nostoc sp. PCC 7120

Gene: alr2495: Cysteine desulfurase (EC 2.8.1.7)
 
Trichodesmium erythraeum IMS101

Gene: Tery_4358: Cysteine desulfurase (EC 2.8.1.7)
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1738: Cysteine desulfurase (EC 2.8.1.7)
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1603: Cysteine desulfurase (EC 2.8.1.7)
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_0391: Cysteine desulfurase (EC 2.8.1.7)
 
Synechococcus sp. WH 8102

Gene: SYNW0322: Cysteine desulfurase (EC 2.8.1.7)
 
Gloeobacter violaceus PCC 7421

Gene: glr1373: Cysteine desulfurase (EC 2.8.1.7)
 
Thermosynechococcus elongatus BP-1

Gene: null: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
ftrC
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
*
Synechococcus elongatus PCC 7942

Site:
position = -101
score = 5.13968
sequence = TTTGACAACATTGATGTTGTTCAA

Site:
position = -63
score = 5.06048
sequence = TTAAGCAACGTCTGTGTTGTTCAA

Gene: Synpcc7942_1734: Ferredoxin thioredoxin reductase catalytic chain
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. WH 8102

Site:
position = -39
score = 4.85631
sequence = TAAGGAAACCAGGTCGTTTCGTAA

Gene: SYNW0318: Ferredoxin thioredoxin reductase catalytic chain
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Ferredoxin thioredoxin reductase catalytic chain
 
CRON 2.
sufR
*
Synechococcus sp. PCC 7002

Site:
position = -39
score = 5.78826
sequence = TTTAACAACAAAAAAGTTGTCAAA

Site:
position = -80
score = 5.54478
sequence = TTTAACAACTGTTTGGTTGTTTTA

Gene: SYNPCC7002_A1815: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Synechocystis sp. PCC 6803

Site:
position = -163
score = 5.56626
sequence = TAAAACAACAGGTAAGTTGTTTTA

Site:
position = -123
score = 5.61869
sequence = ATTAGCAACCCGATTGTTGTCAAA

Gene: sll0088: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Cyanothece sp. ATCC 51142

Site:
position = -109
score = 5.69064
sequence = ATTAACAACTCAATTGTTGTCAAA

Site:
position = -149
score = 5.74771
sequence = TAAAACAACATTTATGTTTCTTTA

Gene: cce_0683: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Cyanothece sp. PCC 8801

Site:
position = -160
score = 5.57277
sequence = AATAACAACCCCATTGTTGTCAAA

Site:
position = -200
score = 5.67787
sequence = TTAAACAACATTTTTGTTGCTCAA

Gene: PCC8801_0414: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Cyanothece sp. PCC 7425

Site:
position = -74
score = 5.83418
sequence = TTTAGCAACACATCAGTTGTCTAA

Site:
position = -113
score = 5.54276
sequence = TTAAACAACTCAGGCGTTGCTTAA

Gene: Cyan7425_3451: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Microcystis aeruginosa NIES-843

Site:
position = -182
score = 5.89491
sequence = TTAAACAACAATAAAGTTGTTTAA

Site:
position = -142
score = 5.68911
sequence = ATTAACAACAAAGCTGTTGTCAAA

Gene: MAE_23100: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Nostoc sp. PCC 7120

Site:
position = -101
score = 5.94534
sequence = TAAAACAACATCGATGTTGTTTAA

Site:
position = -56
score = 5.74124
sequence = ATTAACAACAACAATGTTGTCAAA

Gene: all2491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Trichodesmium erythraeum IMS101

Site:
position = -212
score = 6.03008
sequence = TTAAACAACTTATTTGTTGTTTAA

Gene: Tery_4354: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Synechococcus elongatus PCC 7942

Site:
position = -98
score = 5.65463
sequence = TTGAACAACATCAATGTTGTCAAA

Site:
position = -136
score = 5.72133
sequence = TTGAACAACACAGACGTTGCTTAA

Gene: Synpcc7942_1733: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Prochlorococcus marinus str. MIT 9313

Site:
position = -204
score = 5.03297
sequence = AAACGAAACCTATTGGTTTCGTTT

Gene: PMT1607: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Synechococcus sp. JA-3-3Ab

Site:
position = -119
score = 5.95767
sequence = TAAAACAACACGGTTGTTGCTTAA

Gene: CYA_2189: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
*
Synechococcus sp. WH 8102

Site:
position = -68
score = 4.87451
sequence = TTACGAAACGACCTGGTTTCCTTA

Gene: SYNW0317: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
 
Gloeobacter violaceus PCC 7421
*
Thermosynechococcus elongatus BP-1

Site:
position = -40
score = 5.89961
sequence = TTTAGCAACAAAACGGTTGTTTTA

Site:
position = -78
score = 5.65142
sequence = TTAAGCAACGAGATGGTTGCTTTA

Gene: tlr0491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
 
CRON 3.
nifJ
*
Synechococcus sp. PCC 7002

Site:
position = -152
score = 5.11538
sequence = TTTAGCAAGCATTTTGTTGTTAAA

Gene: SYNPCC7002_A1443: Pyruvate oxidoreductase
*
Synechocystis sp. PCC 6803

Site:
position = -172
score = 4.92307
sequence = AAAAACAATCTTGACGTTGTTTAA

Gene: sll0741: Pyruvate oxidoreductase
*
Cyanothece sp. ATCC 51142

Site:
position = -133
score = 5.56327
sequence = AAAAACAACCCTAATGTTGTGTTA

Gene: cce_0953: Pyruvate oxidoreductase
*
Cyanothece sp. PCC 8801

Site:
position = -134
score = 5.46903
sequence = AAAAACAACCATGAAGTTGTCTTA

Gene: PCC8801_3918: Pyruvate oxidoreductase
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_4369: Pyruvate oxidoreductase
 
Microcystis aeruginosa NIES-843

Gene: MAE_38140: Pyruvate oxidoreductase
 2
Nostoc sp. PCC 7120

Gene: alr2803: Pyruvate oxidoreductase

Gene: alr1911: Pyruvate oxidoreductase
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_2384: Pyruvate oxidoreductase
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Pyruvate oxidoreductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD