Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 12 2
Bacillus amyloliquefaciens FZB42 12 2
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 12 2
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16 10 2
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -69
score = -1.47248
sequence = ACTATTGATTAACTTTTGGTTT

Gene: BSU39770: Transcriptional regulator of myo-inositol utilization, DeoR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -69
score = -0.587287
sequence = ACTATTGATTAACTTCTGGTGT

Gene: RBAM_036790: Transcriptional regulator of myo-inositol utilization, DeoR family
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -66
score = -1.71918
sequence = ATTATTGGTTAACTTTTGGGTT

Gene: BLi04252: Transcriptional regulator of myo-inositol utilization, DeoR family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -160
score = -2.01547
sequence = CTTTTTGATCATTTGTTGGTTA

Gene: ABC0421: Transcriptional regulator of myo-inositol utilization, DeoR family
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of myo-inositol utilization, DeoR family
iolS
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39780: Oxidoreductase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036800: Oxidoreductase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04253: Oxidoreductase
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1667: Oxidoreductase
 
Oceanobacillus iheyensis HTE831

Gene: OB0446: Oxidoreductase
 
Paenibacillus sp. JDR-2
Oxidoreductase
 
CRON 2.
iolA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -196
score = 6.44205
sequence = TAACCAAGAAATGACCAAAAAG

Gene: BSU39760: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -224
score = 6.54509
sequence = TAACCAAGAAATGACCAAAACA

Site:
position = -213
score = 4.5549
sequence = TGACCAAAACATAACCTGTAAA

Gene: RBAM_036780: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -242
score = 6.44205
sequence = TAACCAAGAAGTGACCAAAACA

Gene: BLi04251: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1887: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -66
score = 5.91122
sequence = TAACCAACAAATGATCAAAAAG

Gene: ABC0422: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1951: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
iolB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39750: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036770: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04250: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1889: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2320: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Bacillus clausii KSM-K16

Gene: ABC0423: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1953: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39740: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036760: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04249: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1888: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2319: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Bacillus clausii KSM-K16

Gene: ABC0424: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1950: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
5-keto-2-deoxygluconokinase (EC 2.7.1.92)
iolD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39730: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036750: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04248: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1891: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2318: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Bacillus clausii KSM-K16

Gene: ABC0425: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1948: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
iolE
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39720: Inosose dehydratase (EC 4.2.1.44)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036740: Inosose dehydratase (EC 4.2.1.44)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04247: Inosose dehydratase (EC 4.2.1.44)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1890: Inosose dehydratase (EC 4.2.1.44)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2317: Inosose dehydratase (EC 4.2.1.44)
 
Bacillus clausii KSM-K16

Gene: ABC0426: Inosose dehydratase (EC 4.2.1.44)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1949: Inosose dehydratase (EC 4.2.1.44)
Inosose dehydratase (EC 4.2.1.44)
iolF
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39710: Minor myo-inositol transporter IolF
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036730: Minor myo-inositol transporter IolF
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04246: Minor myo-inositol transporter IolF
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Minor myo-inositol transporter IolF
iolG
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39700: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036720: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04245: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2316: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus clausii KSM-K16

Gene: ABC0427: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolH
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39690: putative sugar-phosphate epimerase/isomerase IolH
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036710: putative sugar-phosphate epimerase/isomerase IolH
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04244: putative sugar-phosphate epimerase/isomerase IolH
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
putative sugar-phosphate epimerase/isomerase IolH
iolI
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39680: Inosose isomerase (EC 5.3.99.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036700: Inosose isomerase (EC 5.3.99.-)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04243: Inosose isomerase (EC 5.3.99.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1892: Inosose isomerase (EC 5.3.99.-)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2315: Inosose isomerase (EC 5.3.99.-)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Inosose isomerase (EC 5.3.99.-)
iolJ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39670: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036690: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi04242: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1886: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2314: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Bacillus clausii KSM-K16

Gene: ABC0428: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
iolX
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU10850: Scyllo-inositol dehydrogenase (EC 1.1.1.-)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0429: Scyllo-inositol dehydrogenase (EC 1.1.1.-)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Scyllo-inositol dehydrogenase (EC 1.1.1.-)
BH2222
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2222: Na+:myo-inositol cotransporter
 
Bacillus clausii KSM-K16

Gene: ABC0430: Na+:myo-inositol cotransporter
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Na+:myo-inositol cotransporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD