Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FadR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Palmitoyl-CoA; Oleoyl-CoA
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 12 5
Bacillus amyloliquefaciens FZB42 10 5
Bacillus pumilus SAFR-032 14 5
Bacillus licheniformis DSM 13 14 5
Anoxybacillus flavithermus WK1 12 5
Geobacillus kaustophilus HTA426 14 6
Bacillus cereus ATCC 14579 11 4
Bacillus halodurans C-125 13 4
Bacillus clausii KSM-K16 12 4
Oceanobacillus iheyensis HTE831 10 5
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadN
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = 39
score = 6.74862
sequence = ATGAATGACTATTCATTCAA

Gene: BSU32840: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -39
score = 6.74862
sequence = ATGAATGACTATTCATTCAA

Gene: RBAM_029920: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus pumilus SAFR-032

Site:
position = -39
score = 6.54445
sequence = ATGAATGACTGTTCATTCAA

Gene: BPUM_2942: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus licheniformis DSM 13

Site:
position = -39
score = 6.81767
sequence = ATGAATGAGTATTCATTCAA

Gene: BLi03466: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = -40
score = 6.54445
sequence = ATGAATGACCATTCATTCAA

Gene: GK3008: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus cereus ATCC 14579

Site:
position = -38
score = 6.50212
sequence = TTGAATGAGCATTCATTCAA

Gene: BC5004: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus halodurans C-125

Site:
position = -36
score = 6.45033
sequence = ATGAATGAGTATTCATTCGT

Gene: BH3488: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Bacillus clausii KSM-K16

Site:
position = -46
score = 5.94346
sequence = ATGAATGAGTGTTCATTCGG

Gene: ABC2990: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 6.6135
sequence = ATGAATGAGCATTCATTCAA

Gene: OB2395: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0489: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
fadA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32830: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029910: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2941: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus licheniformis DSM 13

Gene: BLi03465: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2481: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Geobacillus kaustophilus HTA426

Gene: GK3007: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus cereus ATCC 14579

Gene: BC5003: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus halodurans C-125

Gene: BH3487: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Bacillus clausii KSM-K16

Gene: ABC2989: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Oceanobacillus iheyensis HTE831

Gene: OB2394: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0490: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
3-ketoacyl-CoA thiolase (EC 2.3.1.16)
fadE
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32820: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029900: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2940: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus licheniformis DSM 13

Gene: BLi03464: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2480: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Geobacillus kaustophilus HTA426

Gene: GK3006: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus cereus ATCC 14579

Gene: BC5002: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus halodurans C-125

Gene: BH3486: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Bacillus clausii KSM-K16

Gene: ABC2988: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanobacillus iheyensis HTE831

Gene: OB2393: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0491: Acyl-CoA dehydrogenase (EC 1.3.99.3)
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 2.
fadF
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -98
score = 6.34699
sequence = TTGACTGAACACTCATTCAT

Gene: BSU37180: Fe-S oxidoreductase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -82
score = 6.34699
sequence = TTGACTGAACACTCATTCAT

Gene: RBAM_034330: Fe-S oxidoreductase
*
Bacillus pumilus SAFR-032

Site:
position = -88
score = 6.55116
sequence = TTGACTGAATACTCATTCAT

Gene: BPUM_3374: Fe-S oxidoreductase
*
Bacillus licheniformis DSM 13

Site:
position = -82
score = 6.34699
sequence = TTGACTGAACACTCATTCAT

Gene: BLi03969: Fe-S oxidoreductase
*
Anoxybacillus flavithermus WK1

Site:
position = -85
score = 6.34699
sequence = TTGACTGAATGCTCATTCAT

Gene: Aflv_2740: Fe-S oxidoreductase
*
Geobacillus kaustophilus HTA426

Site:
position = -106
score = 6.34699
sequence = TTGACTGAATGCTCATTCAT

Gene: GK3398: Fe-S oxidoreductase
*
Bacillus cereus ATCC 14579

Site:
position = -115
score = 5.88965
sequence = TTGACTGAATGCTCACTCAT

Gene: BC5345: Fe-S oxidoreductase
*
Bacillus halodurans C-125

Site:
position = -123
score = 6.47171
sequence = ATGAGTGAATACTCATTCAT

Gene: BH3802: Fe-S oxidoreductase
*
Bacillus clausii KSM-K16

Site:
position = -109
score = 6.15569
sequence = CTGACTGAATGCTCATTCAT

Gene: ABC3892: Fe-S oxidoreductase
*
Oceanobacillus iheyensis HTE831

Site:
position = -106
score = 6.29833
sequence = TTGACTGAATGATCATTCAT

Gene: OB3014: Fe-S oxidoreductase
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0488: Fe-S oxidoreductase
Fe-S oxidoreductase
mmgA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU24170: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_022450: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3373: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus licheniformis DSM 13

Gene: BLi03968: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2739: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Geobacillus kaustophilus HTA426

Gene: GK3397: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus cereus ATCC 14579

Gene: BC5344: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus halodurans C-125

Gene: BH3801: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Bacillus clausii KSM-K16

Gene: ABC3891: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Oceanobacillus iheyensis HTE831

Gene: OB3013: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2766: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Acetyl-CoA acetyltransferase (EC 2.3.1.9)
mmgB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU24160: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_022440: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3372: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus licheniformis DSM 13

Gene: BLi03967: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2738: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Geobacillus kaustophilus HTA426

Gene: GK3395: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus cereus ATCC 14579

Gene: BC5343: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus halodurans C-125

Gene: BH3800: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Bacillus clausii KSM-K16

Gene: ABC3890: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Oceanobacillus iheyensis HTE831

Gene: OB3012: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2767: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
mmgC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU24150: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_022430: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3371: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus licheniformis DSM 13

Gene: BLi03966: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2737: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Geobacillus kaustophilus HTA426

Gene: GK3394: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus cereus ATCC 14579

Gene: BC5342: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus halodurans C-125

Gene: BH3799: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus clausii KSM-K16

Gene: ABC3889: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Oceanobacillus iheyensis HTE831

Gene: OB3011: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2768: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
acdA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU37170: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3370: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Bacillus licheniformis DSM 13

Gene: BLi03965: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2736: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3393: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Bacillus cereus ATCC 14579

Gene: BC5341: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Bacillus halodurans C-125

Gene: BH3798: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB3010: Acyl-CoA dehydrogenase (EC 1.3.99.-)
 
Paenibacillus sp. JDR-2
Acyl-CoA dehydrogenase (EC 1.3.99.-)
GK3396
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK3396: Hypothetical protein
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
 
CRON 3.
fadR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -44
score = 6.86
sequence = ATGAATGAATAGTCATTCAT

Gene: BSU28550: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -38
score = 6.86
sequence = ATGAATGAATAGTCATTCAT

Gene: RBAM_025610: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus pumilus SAFR-032

Site:
position = -41
score = 6.81767
sequence = ATGAATGAATACTCATTCAA

Gene: BPUM_2512: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus licheniformis DSM 13

Site:
position = -43
score = 6.92906
sequence = ATGAATGAGTATTCATTCAT

Gene: BLi03002: Transcriptional regulator of fatty acids degradation, TetR family
*
Anoxybacillus flavithermus WK1

Site:
position = -44
score = 6.8804
sequence = ATGAATGATTATTCATTCAT

Gene: Aflv_0565: Transcriptional regulator of fatty acids degradation, TetR family
*
Geobacillus kaustophilus HTA426

Site:
position = -60
score = 6.12193
sequence = ATGAATGATGGTTCATTCAT

Gene: GK2689: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus cereus ATCC 14579

Site:
position = -45
score = 6.55731
sequence = ATGAATGACTATTCATTCAG

Gene: BC4525: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus halodurans C-125

Site:
position = -38
score = 6.92906
sequence = ATGAATGAATACTCATTCAT

Gene: BH3102: Transcriptional regulator of fatty acids degradation, TetR family
*
Bacillus clausii KSM-K16

Site:
position = -45
score = 6.84419
sequence = ATGAATGAACATTCATTCAT

Gene: ABC2672: Transcriptional regulator of fatty acids degradation, TetR family
*
Oceanobacillus iheyensis HTE831

Site:
position = -50
score = 5.91619
sequence = ATGAATGATCATTCACTCAG

Gene: OB2121: Transcriptional regulator of fatty acids degradation, TetR family
 
Paenibacillus sp. JDR-2
Transcriptional regulator of fatty acids degradation, TetR family
fadB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28540: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025600: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2511: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus licheniformis DSM 13

Gene: BLi03001: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0566: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Geobacillus kaustophilus HTA426

Gene: GK2688: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus cereus ATCC 14579

Gene: BC4524: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus halodurans C-125

Gene: BH3101: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Bacillus clausii KSM-K16

Gene: ABC2671: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Oceanobacillus iheyensis HTE831

Gene: OB2120: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Paenibacillus sp. JDR-2
Enoyl-CoA hydratase (EC 4.2.1.17)
etfB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28530: Electron transfer flavoprotein, beta subunit
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025590: Electron transfer flavoprotein, beta subunit
 
Bacillus pumilus SAFR-032

Gene: BPUM_2510: Electron transfer flavoprotein, beta subunit
 
Bacillus licheniformis DSM 13

Gene: BLi03000: Electron transfer flavoprotein, beta subunit
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0567: Electron transfer flavoprotein, beta subunit
 
Geobacillus kaustophilus HTA426

Gene: GK2687: Electron transfer flavoprotein, beta subunit
 
Bacillus cereus ATCC 14579

Gene: BC4523: Electron transfer flavoprotein, beta subunit
 
Bacillus halodurans C-125

Gene: BH3100: Electron transfer flavoprotein, beta subunit
 
Bacillus clausii KSM-K16

Gene: ABC2670: Electron transfer flavoprotein, beta subunit
 
Oceanobacillus iheyensis HTE831

Gene: OB2119: Electron transfer flavoprotein, beta subunit
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0487: Electron transfer flavoprotein, beta subunit
Electron transfer flavoprotein, beta subunit
etfA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28520: Electron transfer flavoprotein, alpha subunit
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025580: Electron transfer flavoprotein, alpha subunit
 
Bacillus pumilus SAFR-032

Gene: BPUM_2509: Electron transfer flavoprotein, alpha subunit
 
Bacillus licheniformis DSM 13

Gene: BLi02999: Electron transfer flavoprotein, alpha subunit
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0568: Electron transfer flavoprotein, alpha subunit
 
Geobacillus kaustophilus HTA426

Gene: GK2686: Electron transfer flavoprotein, alpha subunit
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3099: Electron transfer flavoprotein, alpha subunit
 
Bacillus clausii KSM-K16

Gene: ABC2669: Electron transfer flavoprotein, alpha subunit
 
Oceanobacillus iheyensis HTE831

Gene: OB2118: Electron transfer flavoprotein, alpha subunit
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0486: Electron transfer flavoprotein, alpha subunit
Electron transfer flavoprotein, alpha subunit
 
CRON 4.
lcfB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -35
score = 6.51349
sequence = ATGAATGACTATTCATTCAC

Gene: BSU10270: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -44
score = 6.86
sequence = ATGAATGACTATTCATTCAT

Gene: RBAM_010470: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Bacillus pumilus SAFR-032

Site:
position = -44
score = 6.46666
sequence = ATGAATGGTTATTCATTCAT

Gene: BPUM_0969: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Bacillus licheniformis DSM 13

Site:
position = -39
score = 6.26249
sequence = ATGAATGGTCATTCATTCAT

Gene: BLi01103: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Anoxybacillus flavithermus WK1

Site:
position = -41
score = 6.3261
sequence = ATGAATGATGATTCATTCAT

Gene: Aflv_2253: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Geobacillus kaustophilus HTA426

Site:
position = -38
score = 6.26249
sequence = ATGAATGGTCATTCATTCAT

Gene: GK0668: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 6.92906
sequence = ATGAATGAGTATTCATTCAT

Gene: OB1176: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Paenibacillus sp. JDR-2
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 5.
Aflv_1606
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
*
Anoxybacillus flavithermus WK1

Site:
position = -53
score = 6.46483
sequence = ATGAATGAATATTCATTCTT

Gene: Aflv_1606: hypothetical Zn-dependent hydrolase
*
Geobacillus kaustophilus HTA426

Site:
position = -76
score = 5.50587
sequence = AAAAATGAATGATCATTCAT

Gene: GK1401: hypothetical Zn-dependent hydrolase
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -38
score = 6.41459
sequence = GTGAATGATTACTCATTCAT

Gene: ABC0525: hypothetical Zn-dependent hydrolase
*
Oceanobacillus iheyensis HTE831

Site:
position = -73
score = 6.61389
sequence = ATGACTGATTATTCATTCAT

Gene: OB0204: hypothetical Zn-dependent hydrolase
 
Paenibacillus sp. JDR-2
hypothetical Zn-dependent hydrolase
 
CRON 6.
ykuF
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -36
score = 6.4225
sequence = TTGAATGAATAATCATTCAC

Gene: BSU14060: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -40
score = 6.76901
sequence = ATGAATGATTATTCATTCAA

Gene: RBAM_013850: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34)
*
Bacillus pumilus SAFR-032

Site:
position = -40
score = 6.74862
sequence = ATGAATGAATAGTCATTCAA

Gene: BPUM_1303: short chain dehydrogenase
*
Bacillus licheniformis DSM 13

Site:
position = -36
score = 6.81767
sequence = TTGAATGAATACTCATTCAT

Gene: BLi01620: Oxidoreductase, short chain dehydrogenase/reductase family
*
Anoxybacillus flavithermus WK1

Site:
position = -37
score = 6.46666
sequence = ATGAATGAATAACCATTCAT

Gene: Aflv_1909: short chain dehydrogenase
*
Geobacillus kaustophilus HTA426

Site:
position = -34
score = 6.49459
sequence = ATGAATGAGTAATCAGTCAT

Gene: GK1044: Oxidoreductase, short-chain dehydrogenase/reductase family
*
Bacillus cereus ATCC 14579

Site:
position = -29
score = 5.17853
sequence = ATGAATGTGTATTCATTTTT

Gene: BC3990: 2,4-dienoyl-CoA reductase [NADPH]
*
Bacillus halodurans C-125

Site:
position = -38
score = 6.82559
sequence = TTGAATGAATATTCATTCAA

Gene: BH2144: 2,4-dienoyl-CoA reductase (NADPH)
 
Bacillus clausii KSM-K16

Gene: ABC1993: Oxidoreductase, short-chain dehydrogenase/reductase family
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34)
fadG
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU14071: hypothetical protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD