Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YiaJ - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 10 2
Salmonella typhimurium LT2 11 2
Citrobacter koseri ATCC BAA-895 6 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568 8 2
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yiaJ
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -151
score = 6.32152
sequence = ATGCGAAACTTGATTTCAAAT

Gene: b3574: transcriptional regulator of L-lyxose catabolism, IclR family
*
Salmonella typhimurium LT2

Site:
position = -168
score = 6.19118
sequence = ATGCGAAATCTAGTTCCAAAT

Gene: STM3667: transcriptional regulator of L-lyxose catabolism, IclR family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -167
score = 6.54484
sequence = ATGCGAAATCTGATTTCAAAT

Gene: CKO_05032: transcriptional regulator of L-lyxose catabolism, IclR family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -287
score = 6.1361
sequence = ATGCGAAATTCAATTTCAAAA

Gene: Spro_3928: transcriptional regulator of L-lyxose catabolism, IclR family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
transcriptional regulator of L-lyxose catabolism, IclR family
 
CRON 2.
yiaK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -70
score = 6.36801
sequence = ATTTGAAATCAAGTTTCGCAT

Gene: b3575: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
*
Salmonella typhimurium LT2

Site:
position = -82
score = 6.02193
sequence = ATTTGGAACTAGATTTCGCAT

Gene: STM3668: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
*
Citrobacter koseri ATCC BAA-895

Site:
position = -72
score = 6.54484
sequence = ATTTGAAATCAGATTTCGCAT

Gene: CKO_05033: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -74
score = 6.09968
sequence = ATTTGAAATGCAATTCCGCAT

Gene: Spro_3933: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
yiaL
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3576: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM3669: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05034: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3934: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
cheX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM3670: putative chemotaxis protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05035: putative chemotaxis protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative chemotaxis protein
yiaM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3577: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
 
Salmonella typhimurium LT2

Gene: STM3671: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
yiaN
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3578: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
 
Salmonella typhimurium LT2

Gene: STM3672: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
yiaO
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3579: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
 
Salmonella typhimurium LT2

Gene: STM3673: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
lyxK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3580: L-xylulose kinase
 
Salmonella typhimurium LT2

Gene: STM3674: L-xylulose kinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05037: L-xylulose kinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3936: L-xylulose kinase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-xylulose kinase
sgbH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3581: 3-keto-L-gulonate 6-phosphate decarboxylase
 
Salmonella typhimurium LT2

Gene: STM3675: 3-keto-L-gulonate 6-phosphate decarboxylase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05039: 3-keto-L-gulonate 6-phosphate decarboxylase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3937: 3-keto-L-gulonate 6-phosphate decarboxylase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
3-keto-L-gulonate 6-phosphate decarboxylase
sgbU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3582: putative 3-hexulose-6-phosphate isomerase
 
Salmonella typhimurium LT2

Gene: STM3676: putative 3-hexulose-6-phosphate isomerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05040: putative 3-hexulose-6-phosphate isomerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3938: putative 3-hexulose-6-phosphate isomerase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative 3-hexulose-6-phosphate isomerase
sgbE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3583: L-ribulose-5-phosphate 4-epimerase
 
Salmonella typhimurium LT2

Gene: STM3677: L-ribulose-5-phosphate 4-epimerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05041: L-ribulose-5-phosphate 4-epimerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3939: L-ribulose-5-phosphate 4-epimerase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-ribulose-5-phosphate 4-epimerase
sgbT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05036: predicted 3-dehydro-L-gulonate MFS transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3935: predicted 3-dehydro-L-gulonate MFS transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 3-dehydro-L-gulonate MFS transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD