Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 1 1
Salmonella typhimurium LT2 1 1
Citrobacter koseri ATCC BAA-895 1 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 1 1
Enterobacter sp. 638 1 1
Erwinia amylovora ATCC 49946 1 1
Yersinia pestis KIM 1 1
Serratia proteamaculans 568 1 1
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202 1 1
Proteus mirabilis HI4320 1 1
Photorhabdus luminescens subsp. laumondii TTO1 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -64
score = 7.66997
sequence = ACTCTGGAGTCGACTCCAGAGT

Gene: b3469: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Salmonella typhimurium LT2

Site:
position = -67
score = 7.66997
sequence = ACTCTGGAGTCGACTCCAGAGT

Gene: STM3576: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -67
score = 7.66997
sequence = ACTCTGGAGTCGACTCCAGAGT

Gene: CKO_04898: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -67
score = 7.66997
sequence = ACTCTGGAGTCGACTCCAGAGT

Gene: KPN_03835: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Enterobacter sp. 638

Site:
position = -66
score = 7.66997
sequence = ACTCTGGAGTCGACTCCAGAGT

Gene: Ent638_3873: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Erwinia amylovora ATCC 49946

Site:
position = -76
score = 6.91836
sequence = ACTCTGGAGCTAACTCCAGAGT

Gene: EAM_3299: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Yersinia pestis KIM

Site:
position = -135
score = 7.11385
sequence = ACTCTGGAGTTGGCTCCAAGGT

Gene: y0410: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Serratia proteamaculans 568

Site:
position = -69
score = 7.41844
sequence = ACTCTGGAGTTGACTCCAGGGT

Gene: Spro_0209: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4352: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Edwardsiella tarda EIB202

Site:
position = -71
score = 7.32001
sequence = ACTCTGGAGTCGACTCCAACGT

Gene: ETAE_0137: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Proteus mirabilis HI4320

Site:
position = -74
score = 6.5129
sequence = ACTCTGGACTCTACTCCAAGCT

Gene: PMI3600: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -70
score = 7.09971
sequence = ACTCTGGAGTAGGCTCCAAAGT

Gene: plu4108: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD