Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EbgR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 6 2
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568 6 3
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ebgA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -94
score = 6.24544
sequence = CTACTTTTTAGTAAAAATTTT

Gene: b3076: Evolved beta-D-galactosidase, alpha subunit
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -59
score = 6.1913
sequence = GTGAATTTTACTAAATATTTA

Gene: Spro_1973: Evolved beta-D-galactosidase, alpha subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Evolved beta-D-galactosidase, alpha subunit
ebgC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3077: Evolved beta-D-galactosidase, beta subunit
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1974: Evolved beta-D-galactosidase, beta subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Evolved beta-D-galactosidase, beta subunit
ygjI
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3078: predicted beta-galactoside transporter, AAP family
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1975: predicted beta-galactoside transporter, AAP family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted beta-galactoside transporter, AAP family
ygjJ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3079: hypothetical protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -160
score = 6.43443
sequence = GTATTTTTTACTAAATATTTT

Gene: Spro_1971: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ygjK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3080: predicted glycosyl hydrolase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1970: predicted glycosyl hydrolase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted glycosyl hydrolase
 
CRON 2.
ebgR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -201
score = 5.73975
sequence = TAAAATTTTACTAAACTATAG

Gene: b3075: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -223
score = 5.85515
sequence = AAAATATTTAGTAAAAAATAC

Gene: Spro_1972: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Evolved beta-D-galactosidase transcriptional repressor, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD