Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagC - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor (activator)
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 20 8
Salmonella typhimurium LT2 17 6
Citrobacter koseri ATCC BAA-895 16 5
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 10 4
Enterobacter sp. 638 16 5
Erwinia amylovora ATCC 49946 5 2
Yersinia pestis KIM 15 5
Serratia proteamaculans 568 10 4
Erwinia carotovora subsp. atroseptica SCRI1043 7 3
Edwardsiella tarda EIB202 7 3
Proteus mirabilis HI4320 12 4
Photorhabdus luminescens subsp. laumondii TTO1 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glmU
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -233
score = 4.81592
sequence = GTTTATTCATTGATCGAAATAAG

Gene: b3730: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Salmonella typhimurium LT2

Site:
position = -233
score = 4.84674
sequence = CTTTATTTATGGAGTAAAAAAAC

Gene: STM3862: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -233
score = 4.80943
sequence = CTTTATTCATGGGTCAAAAAAAT

Gene: CKO_00067: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -248
score = 4.72425
sequence = CTTTATTCAGGTGGCGAAAAAAC

Gene: KPN_04135: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Enterobacter sp. 638

Site:
position = -233
score = 5.1957
sequence = CTTTATTCATGAGGCGAAAAAAT

Gene: Ent638_4135: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Erwinia amylovora ATCC 49946

Gene: EAM_3472: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Yersinia pestis KIM

Site:
position = -235
score = 4.7892
sequence = CTTGTTTTCTGTCGTAAAATAAG

Gene: y4133: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Serratia proteamaculans 568

Site:
position = -242
score = 5.02956
sequence = CTTTTTTTTTGTTTTAAAATAAG

Gene: Spro_0010: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4509: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
 
Edwardsiella tarda EIB202

Gene: ETAE_3535: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Proteus mirabilis HI4320

Site:
position = -84
score = 5.32445
sequence = AATATTTTGTGTAACGAAATATG

Gene: PMI3066: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -85
score = 4.65114
sequence = GCTTTTTTGTATTGCGAAATATG

Gene: plu0038: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
glmS
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3729: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Salmonella typhimurium LT2

Gene: STM3861: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00066: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04134: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Enterobacter sp. 638

Gene: Ent638_4136: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Erwinia amylovora ATCC 49946

Gene: EAM_3471: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Yersinia pestis KIM

Gene: y4132: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Serratia proteamaculans 568

Gene: Spro_0011: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4508: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Edwardsiella tarda EIB202

Gene: ETAE_3536: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Proteus mirabilis HI4320

Gene: PMI3067: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0037: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
CRON 2.
nanC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -608
score = 4.30444
sequence = AATTATTTATAAAACAAATAGTT

Site:
position = -715
score = 4.86157
sequence = CATATTTCATGATGAGAATTATG

Gene: b4311: N-acetylneuraminic acid outer membrane channel protein NanC
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01396: N-acetylneuraminic acid outer membrane channel protein NanC
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
N-acetylneuraminic acid outer membrane channel protein NanC
nanM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4310: N-acetylneuraminic acid-induced hypothetical transmembrane protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
N-acetylneuraminic acid-induced hypothetical transmembrane protein
 
CRON 3.
nagE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -146
score = 5.90523
sequence = TTTAATTTGCGATACGAATTAAA

Gene: b0679: PTS system, N-acetylglucosamine-specific IIABC component
*
Salmonella typhimurium LT2

Site:
position = -241
score = 4.82487
sequence = GATTTTTTGAATCATAAAATAAG

Site:
position = -147
score = 5.79918
sequence = TTTAATTTGCGAGGCGAATTAAT

Gene: STM0685: PTS system, N-acetylglucosamine-specific IIABC component
*
Citrobacter koseri ATCC BAA-895

Site:
position = -151
score = 5.96973
sequence = TTTAATTTGCGATACGAATTAAT

Gene: CKO_02485: PTS system, N-acetylglucosamine-specific IIABC component
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -123
score = 5.96973
sequence = TTTAATTTGCGATACGAATTAAT

Gene: KPN_00700: PTS system, N-acetylglucosamine-specific IIABC component
*
Enterobacter sp. 638

Site:
position = -132
score = 5.96973
sequence = TTTAATTTGCGATACGAATTAAT

Gene: Ent638_1194: PTS system, N-acetylglucosamine-specific IIABC component
*
Erwinia amylovora ATCC 49946

Site:
position = -132
score = 5.38068
sequence = ATTAATTTGCTGTACGAATTTAT

Site:
position = -226
score = 4.82487
sequence = GATTTTTTGAATCATAAAATAAG

Gene: EAM_1148: PTS system, N-acetylglucosamine-specific IIABC component
*
Yersinia pestis KIM

Site:
position = -176
score = 5.98176
sequence = TTTAATTTGCGTTACGAAATAAT

Site:
position = -270
score = 5.1614
sequence = ATTTTTTCGGATGATAAAATAAG

Gene: y1203: PTS system, N-acetylglucosamine-specific IIABC component
*
Serratia proteamaculans 568

Site:
position = -132
score = 5.98176
sequence = TTTAATTTGCGATACGAAATAAT

Gene: Spro_1228: PTS system, N-acetylglucosamine-specific IIABC component
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -172
score = 5.67096
sequence = TTTAATTTGTGTAGCGAATTATT

Gene: ECA1327: PTS system, N-acetylglucosamine-specific IIABC component
*
Edwardsiella tarda EIB202

Site:
position = -127
score = 5.62978
sequence = TTTAATTTGCGGAGAAAAATAAT

Gene: ETAE_2616: PTS system, N-acetylglucosamine-specific IIABC component
*
Proteus mirabilis HI4320

Site:
position = -120
score = 6.06846
sequence = ATTAATTTGCGATACAAAATAAT

Gene: PMI0455: PTS system, N-acetylglucosamine-specific IIABC component
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -88
score = 5.26953
sequence = ATTATTTTTCAACTAAAAATAAG

Gene: plu1318: PTS system, N-acetylglucosamine-specific IIABC component
PTS system, N-acetylglucosamine-specific IIABC component
 
CRON 4.
fimB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -763
score = 4.86157
sequence = CATAATTCTCATCATGAAATATG

Gene: b4312: type 1 fimbriae regulatory protein FimB
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03705: type 1 fimbriae regulatory protein FimB
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03285: type 1 fimbriae regulatory protein FimB
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 2
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0260: type 1 fimbriae regulatory protein FimB

Gene: plu1991: type 1 fimbriae regulatory protein FimB
type 1 fimbriae regulatory protein FimB
 
CRON 5.
chbB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -230
score = 5.11496
sequence = CTTAATTATCTTCGCGAATTATT

Gene: b1738: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
*
Salmonella typhimurium LT2

Site:
position = -232
score = 5.10939
sequence = CTTATTTATTATCGCGAATTATT

Gene: STM1312: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -217
score = 5.14335
sequence = CTTATTTATTGTCGCGAAATATT

Gene: CKO_01763: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -197
score = 4.93151
sequence = CTTATTTATTTGCGCGAATTATT

Gene: Ent638_1706: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -242
score = 4.98718
sequence = CTTATTTCGTCAAGAAAAAAATT

Gene: y1251: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
 
Serratia proteamaculans 568

Gene: Spro_0834: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -255
score = 4.75682
sequence = CAAATTTTGTAACGCGAAACAAT

Gene: PMI2956: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
chbC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1737: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Salmonella typhimurium LT2

Gene: STM1313: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01762: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01231: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Enterobacter sp. 638

Gene: Ent638_1707: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1252: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Serratia proteamaculans 568

Gene: Spro_0835: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2955: PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, chitobiose-specific IIC component (EC 2.7.1.69)
chbA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1736: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Salmonella typhimurium LT2

Gene: STM1314: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01761: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01232: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Enterobacter sp. 638

Gene: Ent638_1708: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1253: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2954: N,N'-diacetylchitobiose-specific PTS system, EIIA component
 
Photorhabdus luminescens subsp. laumondii TTO1
N,N'-diacetylchitobiose-specific PTS system, EIIA component
chbR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1735: Chitobiose-specific regulator ChbR, AraC family
 
Salmonella typhimurium LT2

Gene: STM1315: Chitobiose-specific regulator ChbR, AraC family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01760: Chitobiose-specific regulator ChbR, AraC family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01233: Chitobiose-specific regulator ChbR, AraC family
 
Enterobacter sp. 638

Gene: Ent638_1709: Chitobiose-specific regulator ChbR, AraC family
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1254: Chitobiose-specific regulator ChbR, AraC family
 
Serratia proteamaculans 568

Gene: Spro_0837: Chitobiose-specific regulator ChbR, AraC family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2953: Chitobiose-specific regulator ChbR, AraC family
 
Photorhabdus luminescens subsp. laumondii TTO1
Chitobiose-specific regulator ChbR, AraC family
chbF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1734: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Salmonella typhimurium LT2

Gene: STM1316: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01759: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01234: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Enterobacter sp. 638

Gene: Ent638_1710: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2952: Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
 
Photorhabdus luminescens subsp. laumondii TTO1
Chitobiose-specific 6-phospho-beta-glucosidase ChbF (EC 3.2.1.86)
chbG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1733: Cellobiose phosphotransferase system YdjC-like protein
 
Salmonella typhimurium LT2

Gene: STM1317: Cellobiose phosphotransferase system YdjC-like protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01758: Cellobiose phosphotransferase system YdjC-like protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01235: Cellobiose phosphotransferase system YdjC-like protein
 
Enterobacter sp. 638

Gene: Ent638_1711: Cellobiose phosphotransferase system YdjC-like protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1255: Cellobiose phosphotransferase system YdjC-like protein
 
Serratia proteamaculans 568

Gene: Spro_0838: Cellobiose phosphotransferase system YdjC-like protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2951: Cellobiose phosphotransferase system YdjC-like protein
 
Photorhabdus luminescens subsp. laumondii TTO1
Cellobiose phosphotransferase system YdjC-like protein
 
CRON 6.
galP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -39
score = 5.23663
sequence = CTTAATTCACAATAAAAAATAAC

Gene: b2943: D-galactose transporter
*
Salmonella typhimurium LT2

Site:
position = -139
score = 4.68583
sequence = TATTTTTCAGATAATTAAATAAT

Gene: STM3091: D-galactose transporter
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04318: D-galactose transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03376: D-galactose transporter
 
Enterobacter sp. 638

Gene: Ent638_3347: D-galactose transporter
 
Erwinia amylovora ATCC 49946

Gene: EAM_2827: D-galactose transporter
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1160: D-galactose transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2966: D-galactose transporter
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-galactose transporter
 
CRON 7.
nagB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -209
score = 5.90523
sequence = TTTAATTCGTATCGCAAATTAAA

Site:
position = -115
score = 4.58906
sequence = CTTATTTTATCATTCAAAAAATC

Gene: b0678: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Salmonella typhimurium LT2

Site:
position = -202
score = 5.79918
sequence = ATTAATTCGCCTCGCAAATTAAA

Site:
position = -108
score = 4.82487
sequence = CTTATTTTATGATTCAAAAAATC

Gene: STM0684: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -215
score = 5.96973
sequence = ATTAATTCGTATCGCAAATTAAA

Site:
position = -121
score = 4.58906
sequence = CTTATTTTATCATTCAAAAAATC

Gene: CKO_02486: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -214
score = 5.96973
sequence = ATTAATTCGTATCGCAAATTAAA

Site:
position = -120
score = 4.58906
sequence = CTTATTTTATCATTCAAAAAATC

Gene: KPN_00699: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Enterobacter sp. 638

Site:
position = -215
score = 5.96973
sequence = ATTAATTCGTATCGCAAATTAAA

Site:
position = -121
score = 4.58906
sequence = CTTATTTTATCATTCAAAAAATC

Gene: Ent638_1193: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Erwinia amylovora ATCC 49946

Site:
position = -225
score = 5.38068
sequence = ATAAATTCGTACAGCAAATTAAT

Site:
position = -131
score = 4.82487
sequence = CTTATTTTATGATTCAAAAAATC

Gene: EAM_1147: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Yersinia pestis KIM

Site:
position = -245
score = 5.98176
sequence = ATTATTTCGTAACGCAAATTAAA

Site:
position = -151
score = 5.1614
sequence = CTTATTTTATCATCCGAAAAAAT

Gene: y1202: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Serratia proteamaculans 568

Site:
position = -225
score = 5.98176
sequence = ATTATTTCGTATCGCAAATTAAA

Gene: Spro_1227: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -211
score = 5.67096
sequence = AATAATTCGCTACACAAATTAAA

Site:
position = -118
score = 4.62307
sequence = CTTATTTCAAGATTAAAAAAAAC

Gene: ECA1326: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Edwardsiella tarda EIB202

Site:
position = -221
score = 5.62978
sequence = ATTATTTTTCTCCGCAAATTAAA

Site:
position = -127
score = 4.56686
sequence = CTTATTTTATCATTCGAAAAATC

Gene: ETAE_2617: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Proteus mirabilis HI4320

Site:
position = -248
score = 6.06846
sequence = ATTATTTTGTATCGCAAATTAAT

Site:
position = -154
score = 4.76343
sequence = CTTATTTTATGATTAAAAATATC

Gene: PMI0454: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -232
score = 4.97502
sequence = TTTATTTTTCTTGCAAAAATAAG

Site:
position = -138
score = 4.71577
sequence = CTTATTTTAATATAAAAAATATC

Gene: plu1317: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0677: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Salmonella typhimurium LT2

Gene: STM0683: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02487: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00698: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Enterobacter sp. 638

Gene: Ent638_1192: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1146: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Yersinia pestis KIM

Gene: y1201: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Serratia proteamaculans 568

Gene: Spro_1226: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1325: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Edwardsiella tarda EIB202

Gene: ETAE_2618: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Proteus mirabilis HI4320

Gene: PMI0453: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1316: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0676: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Salmonella typhimurium LT2

Gene: STM0682: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02488: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00697: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Enterobacter sp. 638

Gene: Ent638_1191: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Erwinia amylovora ATCC 49946

Gene: EAM_1145: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Yersinia pestis KIM

Gene: y1200: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Serratia proteamaculans 568

Gene: Spro_1225: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1324: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Edwardsiella tarda EIB202

Gene: ETAE_2619: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Proteus mirabilis HI4320

Gene: PMI0452: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1315: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
nagD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0675: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Salmonella typhimurium LT2

Gene: STM0681: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02489: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00696: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Enterobacter sp. 638

Gene: Ent638_1190: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Erwinia amylovora ATCC 49946

Gene: EAM_1144: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Yersinia pestis KIM

Gene: y1199: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Serratia proteamaculans 568

Gene: Spro_1224: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2621: Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Phosphatase NagD predicted to act in N-acetylglucosamine utilization subsystem
 
CRON 8.
manX
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -140
score = 5.19076
sequence = ATTTTTTCGATATCTAAAATAAA

Gene: b1817: PTS system, mannose-specific IIAB component
*
Salmonella typhimurium LT2

Site:
position = -141
score = 5.19076
sequence = TTTTTTTCGATATCTAAAATAAT

Gene: STM1830: PTS system, mannose-specific IIAB component
*
Citrobacter koseri ATCC BAA-895

Site:
position = -139
score = 5.44708
sequence = TTTTTTTCGCTATCTAAAATAAT

Gene: CKO_01161: PTS system, mannose-specific IIAB component
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -203
score = 5.00222
sequence = TATTTTTTGCGCTGCAAAATTAT

Site:
position = -138
score = 5.22005
sequence = ATTTTTTCACTGTCTAAAATAAT

Gene: KPN_02333: PTS system, mannose-specific IIAB component
*
Enterobacter sp. 638

Site:
position = -141
score = 5.22005
sequence = ATTTTTTCACTGTCTAAAATAAT

Gene: Ent638_2386: PTS system, mannose-specific IIAB component
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -206
score = 5.12982
sequence = ATTTTTTCACTGACTAAAATAAA

Gene: y2551: PTS system, mannose-specific IIAB component
*
Serratia proteamaculans 568

Site:
position = -195
score = 5.12982
sequence = ATTTTTTCACTCACTAAAATAAA

Gene: Spro_2813: PTS system, mannose-specific IIAB component
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -203
score = 5.38983
sequence = ATTTTTTCGATAAGTAAAATAAA

Gene: ECA2385: PTS system, mannose-specific IIAB component
*
Edwardsiella tarda EIB202

Site:
position = -242
score = 5.08753
sequence = TTTTTTTTACTGACTAAAATAAA

Gene: ETAE_1559: PTS system, mannose-specific IIAB component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2697: PTS system, mannose-specific IIAB component
PTS system, mannose-specific IIAB component
manY
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1818: PTS system, mannose-specific IIc component
 
Salmonella typhimurium LT2

Gene: STM1831: PTS system, mannose-specific IIc component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01160: PTS system, mannose-specific IIc component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02334: PTS system, mannose-specific IIc component
 
Enterobacter sp. 638

Gene: Ent638_2387: PTS system, mannose-specific IIc component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2552: PTS system, mannose-specific IIc component
 
Serratia proteamaculans 568

Gene: Spro_2814: PTS system, mannose-specific IIc component
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2386: PTS system, mannose-specific IIc component
 
Edwardsiella tarda EIB202

Gene: ETAE_1558: PTS system, mannose-specific IIc component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2698: PTS system, mannose-specific IIc component
PTS system, mannose-specific IIc component
manZ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1819: PTS system, mannose-specific IID component
 
Salmonella typhimurium LT2

Gene: STM1832: PTS system, mannose-specific IID component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01159: PTS system, mannose-specific IID component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02335: PTS system, mannose-specific IID component
 
Enterobacter sp. 638

Gene: Ent638_2388: PTS system, mannose-specific IID component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2553: PTS system, mannose-specific IID component
 
Serratia proteamaculans 568

Gene: Spro_2815: PTS system, mannose-specific IID component
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2387: PTS system, mannose-specific IID component
 
Edwardsiella tarda EIB202

Gene: ETAE_1557: PTS system, mannose-specific IID component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2699: PTS system, mannose-specific IID component
PTS system, mannose-specific IID component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD