Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GltR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: unknown
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 2
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Pjdr2_3124
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -101
score = 5.43517
sequence = AATATCTGAAAAAATGATATC

Gene: Pjdr2_3124: Major facilitator (MFS) superfamily protein
Major facilitator (MFS) superfamily protein
 
CRON 2.
yrpB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -241
score = 5.84156
sequence = GACATCTCAAAATCAGATATC

Gene: BSU26800: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_028350: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2794: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Bacillus licheniformis DSM 13

Gene: BLi03299: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1368: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Bacillus halodurans C-125

Gene: BH1205: Probable nitronate monooxygenase (EC 1.13.12.16)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB0826: Probable nitronate monooxygenase (EC 1.13.12.16)
*
Paenibacillus sp. JDR-2

Site:
position = -111
score = 5.308
sequence = GCTATCTCTTTTCGGGATAGC

Gene: Pjdr2_3122: Probable nitronate monooxygenase (EC 1.13.12.16)
Probable nitronate monooxygenase (EC 1.13.12.16)
 
CRON 3.
gltR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -37
score = 5.84156
sequence = GACATCTCAAAATCAGATATC

Gene: BSU26670: Transcriptional regulator, LysR family
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -50
score = 5.43517
sequence = GATATCATTTTTTCAGATATT

Gene: Pjdr2_3123: Transcriptional regulator, LysR family
Transcriptional regulator, LysR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD