Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KdgR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 159 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 11 10
Salmonella typhimurium LT2 15 12
Citrobacter koseri ATCC BAA-895 19 17
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 22 18
Enterobacter sp. 638 30 21
Erwinia amylovora ATCC 49946
Yersinia pestis KIM 19 14
Serratia proteamaculans 568 5 5
Erwinia carotovora subsp. atroseptica SCRI1043 42 31
Edwardsiella tarda EIB202 8 5
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
kdgK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -86
score = 5.32094
sequence = TAATGGAACACTGTTTTAATA

Gene: b3526: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Salmonella typhimurium LT2

Site:
position = -85
score = 4.85834
sequence = TAATGGACCGATGTTTTAATA

Gene: STM3612: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -87
score = 5.33122
sequence = TAATGGAACGATGTTTTAATA

Gene: CKO_04968: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -87
score = 5.33122
sequence = TAATGGAACGATGTTTTAATA

Gene: KPN_03876: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Enterobacter sp. 638

Site:
position = -84
score = 5.08668
sequence = TTATGGAACGACGTTTTAATA

Gene: Ent638_3923: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -225
score = 5.08791
sequence = ATTTAAAACACCGTTTTAATC

Gene: y3838: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Serratia proteamaculans 568

Site:
position = -105
score = 6.17307
sequence = AAATAAAACGTTGTTTTATTT

Gene: Spro_4750: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -125
score = 5.37161
sequence = AAATAAAACATCGTTTCAAGA

Gene: ECA4360: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
*
Edwardsiella tarda EIB202

Site:
position = -91
score = 5.37252
sequence = AAACAGAACGTTGTTTTATTT

Gene: ETAE_3377: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
CRON 2.
ppsR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -131
score = 5.25789
sequence = AAATGAAATGCTGTTTTCATA

Gene: b1703: PEP synthetase regulatory protein
*
Salmonella typhimurium LT2

Site:
position = -131
score = 4.85744
sequence = AAATGAAACACACTTTTCATT

Gene: STM1348: PEP synthetase regulatory protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -107
score = 5.46645
sequence = TATAAAAATAGCGTTTCATTT

Gene: CKO_01727: PEP synthetase regulatory protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -97
score = 5.12755
sequence = AACAAAAATAGCGTTTCAATT

Gene: KPN_02161: PEP synthetase regulatory protein
*
Enterobacter sp. 638

Site:
position = -107
score = 5.33969
sequence = ATTAAAAACACCATTTCATTT

Gene: Ent638_1744: PEP synthetase regulatory protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1645: PEP synthetase regulatory protein
 
Yersinia pestis KIM

Gene: y1929: PEP synthetase regulatory protein
*
Serratia proteamaculans 568

Site:
position = -134
score = 5.16114
sequence = ATTTGAAATAGTGTTTTACTT

Gene: Spro_2173: PEP synthetase regulatory protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -94
score = 5.63269
sequence = TAATGAAATGGCGTTTTAATA

Gene: ECA1852: PEP synthetase regulatory protein
 
Edwardsiella tarda EIB202

Gene: ETAE_1791: PEP synthetase regulatory protein
 
Proteus mirabilis HI4320

Gene: PMI1422: PEP synthetase regulatory protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2629: PEP synthetase regulatory protein
PEP synthetase regulatory protein
 
CRON 3.
kduI
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -63
score = 5.4325
sequence = AAACGAAACAGTGTTTCACTA

Site:
position = -130
score = 6.25775
sequence = AAATGAAACATTGTTTTATTT

Gene: b2843: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
*
Salmonella typhimurium LT2

Site:
position = -58
score = 5.26534
sequence = AATCAAAACAGTGTTTTGATT

Site:
position = -123
score = 6.231
sequence = AAATGAAACGTTGTTTTATTT

Gene: STM3018: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -51
score = 4.39485
sequence = AAACGGAACGGTGTTTCGCCT

Site:
position = -119
score = 6.231
sequence = AAATGAAACAACGTTTTATTT

Gene: CKO_04220: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -60
score = 4.97537
sequence = AATCGGAACATTGTTTCGTTA

Site:
position = -127
score = 5.40034
sequence = AACTGAAACAACGTTTTAAAT

Gene: Ent638_3296: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -201
score = 5.97045
sequence = TAATAAAACATCATTTCATTT

Gene: y1887: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -209
score = 6.08823
sequence = AAATAAAACATTATTTCATTT

Gene: ECA2400: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
*
Edwardsiella tarda EIB202

Site:
position = -129
score = 5.57573
sequence = AATCAAAACAGCATTTCATTT

Gene: ETAE_1898: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Proteus mirabilis HI4320

Gene: PMI2133: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Photorhabdus luminescens subsp. laumondii TTO1
4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
kduD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2842: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Salmonella typhimurium LT2

Gene: STM3017: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04219: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -139
score = 5.15902
sequence = AAACGGAACTCTGTTTTATTT

Site:
position = -207
score = 5.83027
sequence = AAATGAAACATCGTTTTAAAT

Gene: KPN_03265: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Enterobacter sp. 638

Gene: Ent638_3295: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1886: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2401: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Edwardsiella tarda EIB202

Gene: ETAE_1899: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Proteus mirabilis HI4320

Gene: PMI2132: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Photorhabdus luminescens subsp. laumondii TTO1
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
CRON 4.
kdgF
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -38
score = 5.55738
sequence = AGTTGAAACATTGTTTCAATA

Gene: CKO_04218: Pectin degradation protein KdgF
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -39
score = 5.82635
sequence = AAATGAAACAATGTTTCACTT

Gene: KPN_03255: Pectin degradation protein KdgF
*
Enterobacter sp. 638

Site:
position = -38
score = 5.49445
sequence = AATTAAAACAATGTTTCACTA

Gene: Ent638_3287: Pectin degradation protein KdgF
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -155
score = 5.97045
sequence = AAATGAAATGATGTTTTATTA

Gene: y1888: Pectin degradation protein KdgF
 
Serratia proteamaculans 568

Gene: Spro_2188: Pectin degradation protein KdgF
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -174
score = 6.08823
sequence = AAATGAAATAATGTTTTATTT

Gene: ECA2399: Pectin degradation protein KdgF
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Pectin degradation protein KdgF
 
CRON 5.
yjcB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4060: putative inner membrane protein
*
Salmonella typhimurium LT2

Site:
position = -120
score = 5.38426
sequence = AATAGAAACAATGTTTCATTC

Gene: STM4263: putative inner membrane protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -121
score = 5.11052
sequence = AACAGAAACGTTGTTTCATTC

Gene: CKO_03830: putative inner membrane protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -113
score = 4.94925
sequence = AACAGAAATGGCGTTTCATCA

Gene: KPN_04460: putative inner membrane protein
 
Enterobacter sp. 638

Gene: Ent638_0263: putative inner membrane protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2355: putative inner membrane protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative inner membrane protein
 
CRON 6.
yjgK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -35
score = 6.04806
sequence = AAATGAAACGTTGTTTTAATT

Gene: b4252: cytoplasmic protein involved in polygalacturonate utilization
*
Salmonella typhimurium LT2

Site:
position = -32
score = 5.65171
sequence = AAATAAAACGCTGTTTTAACT

Gene: STM4468: cytoplasmic protein involved in polygalacturonate utilization
*
Citrobacter koseri ATCC BAA-895

Site:
position = -33
score = 6.231
sequence = AAATGAAACGTTGTTTTATTT

Gene: CKO_03553: cytoplasmic protein involved in polygalacturonate utilization
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -33
score = 5.80666
sequence = AAATGAAATGCTGTTTTATAT

Gene: KPN_04658: cytoplasmic protein involved in polygalacturonate utilization
*
Enterobacter sp. 638

Site:
position = -34
score = 6.03996
sequence = AAATGAAACATTGTTTTATAT

Gene: Ent638_0453: cytoplasmic protein involved in polygalacturonate utilization
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -41
score = 5.93342
sequence = TAATAAAACAGCATTTCATTT

Gene: y0739: cytoplasmic protein involved in polygalacturonate utilization
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -41
score = 5.05657
sequence = TTGTAAAACAGGGTTTCATTT

Gene: ECA0383: cytoplasmic protein involved in polygalacturonate utilization
*
Edwardsiella tarda EIB202

Site:
position = -39
score = 5.56606
sequence = AAATAAAACGCAGTTTTATAA

Gene: ETAE_3112: cytoplasmic protein involved in polygalacturonate utilization
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
cytoplasmic protein involved in polygalacturonate utilization
 
CRON 7.
kduD2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -99
score = 5.91189
sequence = TTATAAAACACTGTTTCATTT

Gene: CKO_01753: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -104
score = 5.80902
sequence = AATCAAAACATTGTTTCATTT

Gene: KPN_01240: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
*
Enterobacter sp. 638

Site:
position = -94
score = 5.56972
sequence = TTTTAAAACATCATTTCATTT

Gene: Ent638_1716: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
CRON 8.
ygjV
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -64
score = 5.35657
sequence = ATAAAAAACGGCGTTTCATAA

Gene: b3090: putative transport protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03518: putative transport protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -133
score = 5.17562
sequence = ATATGAAACGGTGTTCTGTTT

Gene: y3597: putative transport protein
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -70
score = 6.16722
sequence = AAATAAAACGGCGTTTCATTT

Gene: ECA0648: putative transport protein
 
Edwardsiella tarda EIB202

Gene: ETAE_0439: putative transport protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative transport protein
 
CRON 9.
rhiT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -190
score = 5.41818
sequence = AATAGAAACGCTGTTTTATAA

Gene: CKO_01081: Rhamnogalacturonide transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -200
score = 4.94227
sequence = AAGAGAAATGCTGTTTTATAA

Gene: KPN_02390: Rhamnogalacturonide transporter
*
Enterobacter sp. 638

Site:
position = -189
score = 5.60112
sequence = AAAAGAAACGCTGTTTTATAA

Gene: Ent638_2444: Rhamnogalacturonide transporter
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -167
score = 4.66061
sequence = AGTTAAAATGCCTTTTTATAA

Gene: ECA3560: Rhamnogalacturonide transporter
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Rhamnogalacturonide transporter
rhiN
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01082: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02389: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Enterobacter sp. 638

Gene: Ent638_2443: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3559: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
CRON 10.
togM
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -211
score = 5.64427
sequence = AATTAAAACGGTGTTTTATAA

Site:
position = -288
score = 5.04706
sequence = TTTTGAAACATCGTTTCGACT

Gene: KPN_03256: oligogalacturonide ABC transporter, inner membrane permease
*
Enterobacter sp. 638

Site:
position = -226
score = 5.12819
sequence = AATTAAAACGCCGTTTTACAA

Gene: Ent638_3289: oligogalacturonide ABC transporter, inner membrane permease
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1884: oligogalacturonide ABC transporter, inner membrane permease
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2403: oligogalacturonide ABC transporter, inner membrane permease
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalacturonide ABC transporter, inner membrane permease
togN
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03257: oligogalacturonide ABC transporter, inner membrane permease
 
Enterobacter sp. 638

Gene: Ent638_3290: oligogalacturonide ABC transporter, inner membrane permease
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1883: oligogalacturonide ABC transporter, inner membrane permease
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2404: oligogalacturonide ABC transporter, inner membrane permease
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalacturonide ABC transporter, inner membrane permease
togA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03258: oligogalacturonide ABC transporter, ATP-binding component
 
Enterobacter sp. 638

Gene: Ent638_3291: oligogalacturonide ABC transporter, ATP-binding component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1882: oligogalacturonide ABC transporter, ATP-binding component
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2405: oligogalacturonide ABC transporter, ATP-binding component
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalacturonide ABC transporter, ATP-binding component
togB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03259: oligogalacturonide ABC transporter, solute-binding periplasmic protein
 
Enterobacter sp. 638

Gene: Ent638_3292: oligogalacturonide ABC transporter, solute-binding periplasmic protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1881: oligogalacturonide ABC transporter, solute-binding periplasmic protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2406: oligogalacturonide ABC transporter, solute-binding periplasmic protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalacturonide ABC transporter, solute-binding periplasmic protein
ogl
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -299
score = 5.83027
sequence = ATTTAAAACGATGTTTCATTT

Site:
position = -103
score = 5.62695
sequence = TAATGAAACAATGTTTTGATA

Gene: KPN_03266: Oligogalacturonate lyase (EC 4.2.2.6)
*2
Enterobacter sp. 638

Site:
position = -105
score = 5.0171
sequence = CATTGAAACGTCGTTTTGATA

Gene: Ent638_3297: Oligogalacturonate lyase (EC 4.2.2.6)

Gene: Ent638_3293: Oligogalacturonate lyase (EC 4.2.2.6)
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -96
score = 5.75768
sequence = AAATGAAACATTGTTTCTATA

Gene: y1875: Oligogalacturonate lyase (EC 4.2.2.6)
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -180
score = 5.75768
sequence = AAATGAAACATTGTTTCTATA

Gene: ECA2426: Oligogalacturonate lyase (EC 4.2.2.6)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Oligogalacturonate lyase (EC 4.2.2.6)
pelW
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -76
score = 5.17457
sequence = GATTGAAACGATGTTTCTATT

Site:
position = -152
score = 4.4974
sequence = AATCAAAACAACGTTCCGACT

Gene: y1885: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -61
score = 5.30503
sequence = AATCAAAACAGTGTTTCTATT

Site:
position = -139
score = 4.4974
sequence = AATCAAAACAACGTTCCGACT

Gene: ECA2402: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Exopolygalacturonate lyase (EC 4.2.2.9)
 
CRON 11.
kdgX
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -34
score = 5.84736
sequence = AAATAAAACATTATTTTAATT

Gene: STM4395: predicted 2-keto-3-deoxygluconate permease
*
Citrobacter koseri ATCC BAA-895

Site:
position = -31
score = 5.22305
sequence = AAATAAAACATTATTTCAAAG

Gene: CKO_03627: predicted 2-keto-3-deoxygluconate permease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -33
score = 5.85179
sequence = AATTGAAACGTCATTTTATTT

Gene: Ent638_0375: predicted 2-keto-3-deoxygluconate permease
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -22
score = 5.76259
sequence = TAACGAAACATCATTTCATTT

Gene: y1734: predicted 2-keto-3-deoxygluconate permease
 
Serratia proteamaculans 568

Gene: Spro_3396: predicted 2-keto-3-deoxygluconate permease
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1684: predicted 2-keto-3-deoxygluconate permease
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 2-keto-3-deoxygluconate permease
 
CRON 12.
togT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -46
score = 5.17095
sequence = TATAAAAACAGTGTTTCAAAA

Gene: KPN_02398: Oligogalacturonide transporter
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -25
score = 6.07481
sequence = AAATGAAACATTGTTTTAATT

Site:
position = -47
score = 4.52273
sequence = AAAGAAAACAGTTATTCATTA

Gene: y2961: Oligogalacturonide transporter
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -38
score = 5.49844
sequence = AACTGAAATATTGTTTCATAT

Site:
position = -60
score = 4.45456
sequence = TAAAGAAATGATAGTTCAATC

Gene: ECA0817: Oligogalacturonide transporter
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Oligogalacturonide transporter
 
CRON 13.
ppsA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -222
score = 5.25789
sequence = TATGAAAACAGCATTTCATTT

Gene: b1702: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Salmonella typhimurium LT2

Site:
position = -226
score = 4.85744
sequence = AATGAAAAGTGTGTTTCATTT

Gene: STM1349: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -249
score = 5.46645
sequence = AAATGAAACGCTATTTTTATA

Gene: CKO_01725: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -254
score = 5.12755
sequence = AATTGAAACGCTATTTTTGTT

Gene: KPN_02160: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Enterobacter sp. 638

Site:
position = -249
score = 5.33969
sequence = AAATGAAATGGTGTTTTTAAT

Gene: Ent638_1745: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1646: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Yersinia pestis KIM

Gene: y1930: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Serratia proteamaculans 568

Site:
position = -364
score = 5.16114
sequence = AAgTaAAACAcTaTTTCAaaT

Gene: Spro_2174: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -227
score = 5.63269
sequence = TATTAAAACGCCATTTCATTA

Gene: ECA1853: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Edwardsiella tarda EIB202

Gene: ETAE_1789: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Proteus mirabilis HI4320

Gene: PMI1421: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2628: Phosphoenolpyruvate synthase (EC 2.7.9.2)
Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
CRON 14.
yeeO
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -7
score = 4.86337
sequence = ATTTGAAATGTGGTTTCACTT

Gene: b1985: predicted multidrug efflux system, MATE family
*
Salmonella typhimurium LT2

Site:
position = -7
score = 4.99513
sequence = TATTGAAATGTGGTTTCAACT

Gene: STM2013: predicted multidrug efflux system, MATE family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -7
score = 4.86837
sequence = ATTTGAAATGAGGTTTCAACT

Gene: CKO_00837: predicted multidrug efflux system, MATE family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -40
score = 5.14332
sequence = ATTTGAAATGTTGTTTCAACA

Gene: KPN_02447: predicted multidrug efflux system, MATE family
*
Enterobacter sp. 638

Site:
position = -74
score = 4.97321
sequence = ATTTGAAATGTAGTTTCAACT

Gene: Ent638_2574: predicted multidrug efflux system, MATE family
 
Erwinia amylovora ATCC 49946

Gene: EAM_2133: predicted multidrug efflux system, MATE family
*
Yersinia pestis KIM

Site:
position = -158
score = 4.84332
sequence = TCATGAAACTATGTTCCATTT

Gene: y2593: predicted multidrug efflux system, MATE family
*
Serratia proteamaculans 568

Site:
position = -39
score = 5.22936
sequence = ATTTGAAATGTTGTTTCACTT

Gene: Spro_3106: predicted multidrug efflux system, MATE family
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -140
score = 5.076
sequence = AATAGAAACGTCATTTTAAAA

Gene: ECA2762: predicted multidrug efflux system, MATE family
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted multidrug efflux system, MATE family
 
CRON 15.
sghX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3835: putative exported protein
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -76
score = 4.01687
sequence = TATCACAATAAGGTTCCATTT

Site:
position = -98
score = 5.58098
sequence = AAATAAAACCTCGTTTCTTTT

Gene: ECA0732: putative exported protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative exported protein
 
CRON 16.
pehN
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_2115: putative polygalacturonase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -37
score = 5.69647
sequence = TATTAAAACGATATTTCATTA

Gene: ECA1190: putative polygalacturonase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative polygalacturonase
 
CRON 17.
rhiA
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -126
score = 4.71378
sequence = ATGTGAAACAGGGTTTCAAAA

Gene: STM4054: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
*
Citrobacter koseri ATCC BAA-895

Site:
position = -138
score = 5.08341
sequence = TTTTAAACCATCGTTTCAATT

Site:
position = -50
score = 4.82111
sequence = AACTAAAACAATGTTTTAACG

Gene: CKO_04899: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -134
score = 4.5088
sequence = TTTCAAACCATCGTTTCAAAA

Site:
position = -49
score = 4.79435
sequence = AACTAAAACAACGTTTTAACG

Gene: Ent638_3876: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2585: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -239
score = 5.58887
sequence = ATATAAAACAGCATTTCATAT

Gene: ECA0357: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
rhiB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM4053: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03566: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_3875: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2586: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0356: predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted rhamnogalacturonide TRAP transporter, small transmembrane subunit
rhiC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM4052: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03565: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_3874: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2587: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0355: predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted rhamnogalacturonide TRAP transporter, large transmembrane subunit
 
CRON 18.
paeY
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -213
score = 5.12866
sequence = TATTAAAATAACATTTCACTT

Gene: ECA3252: pectin acetylesterase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
pectin acetylesterase
pemA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -149
score = 5.28647
sequence = AAATGGAATTGCGTTTCATTT

Gene: y3757: Putative pectinesterase (EC 3.1.1.11)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3253: Putative pectinesterase (EC 3.1.1.11)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Putative pectinesterase (EC 3.1.1.11)
 
CRON 19.
spiX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -54
score = 5.11535
sequence = AATTGAAATACAGTTTTAAAA

Gene: ECA1742: predicted 5-keto-4-deoxyuronate isomerase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted 5-keto-4-deoxyuronate isomerase
 
CRON 20.
pykF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -286
score = 4.98824
sequence = TTTTGAAACGCTGTTTTTGTT

Gene: b1676: Pyruvate kinase (EC 2.7.1.40)
*
Salmonella typhimurium LT2

Site:
position = -286
score = 4.68744
sequence = TTTTGAAACAGGGTTTTCATT

Gene: STM1378: Pyruvate kinase (EC 2.7.1.40)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -286
score = 5.02668
sequence = TTTTGAAACGCTGTTTTCATT

Gene: CKO_01709: Pyruvate kinase (EC 2.7.1.40)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -285
score = 4.99732
sequence = ATTTGAAACGAGGTTTTTATT

Gene: KPN_02133: Pyruvate kinase (EC 2.7.1.40)
*
Enterobacter sp. 638

Site:
position = -286
score = 5.05786
sequence = TTTTGAAACGCCGTTTCCATT

Gene: Ent638_1768: Pyruvate kinase (EC 2.7.1.40)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1657: Pyruvate kinase (EC 2.7.1.40)
 
Yersinia pestis KIM

Gene: y1944: Pyruvate kinase (EC 2.7.1.40)
*
Serratia proteamaculans 568

Site:
position = -203
score = 4.07437
sequence = AAtaacAACAcatTTTCATcT

Gene: Spro_2187: Pyruvate kinase (EC 2.7.1.40)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -259
score = 5.0609
sequence = ATACGGAACGTCGTTTCAATT

Gene: ECA1867: Pyruvate kinase (EC 2.7.1.40)
 
Edwardsiella tarda EIB202

Gene: ETAE_1850: Pyruvate kinase (EC 2.7.1.40)
 
Proteus mirabilis HI4320

Gene: PMI1405: Pyruvate kinase (EC 2.7.1.40)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2613: Pyruvate kinase (EC 2.7.1.40)
Pyruvate kinase (EC 2.7.1.40)
 
CRON 21.
sotA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3234: sugar efflux transporter
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -88
score = 4.97518
sequence = TAATGAAACAAGATTTCTGTT

Gene: ECA2730: sugar efflux transporter
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
sugar efflux transporter
 
CRON 22.
pehA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2105: Polygalacturonase (EC 3.2.1.15)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -152
score = 3.92646
sequence = TATGTAAATGGACTTTTATTA

Site:
position = -65
score = 3.91853
sequence = AAAGGAAGCGTAATTCCTTTT

Site:
position = -100
score = 4.30717
sequence = TTCTATAAAAGTGTTTTATTT

Gene: ECA1095: Polygalacturonase (EC 3.2.1.15)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Polygalacturonase (EC 3.2.1.15)
 
CRON 23.
pelF
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -291
score = 4.91898
sequence = TAATGAAACCATGTTTTACCA

Gene: ECA3112: Pectate lyase precursor (EC 4.2.2.2)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Pectate lyase precursor (EC 4.2.2.2)
pehX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3111: Exo-poly-alpha-D-galacturonosidase precursor (EC 3.2.1.82)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Exo-poly-alpha-D-galacturonosidase precursor (EC 3.2.1.82)
 
CRON 24.
rexZ
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -66
score = 4.40842
sequence = AAATAAATTACCGTTGCGTTA

Site:
position = -138
score = 5.90557
sequence = TAATAAAACTATGTTTCATTT

Gene: ECA4123: transcriptional regulator of exoenzymes
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
transcriptional regulator of exoenzymes
 
CRON 25.
chmX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -172
score = 4.54803
sequence = TATTGAAACGTGATTTCTATC

Gene: ECA3902: methyl-accepting chemotaxis protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
methyl-accepting chemotaxis protein
 
CRON 26.
kdgT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -140
score = 6.01103
sequence = AAATAAAACAGCGTTTCAATT

Gene: b3909: 2-keto-3-deoxygluconate permease
 
Salmonella typhimurium LT2
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -147
score = 5.63978
sequence = AAATGAAACATAGTTTTGTTA

Gene: CKO_03092: 2-keto-3-deoxygluconate permease

Site:
position = -231
score = 5.73285
sequence = AACTAAAACAGTGTTTTATTT

Gene: CKO_03757: 2-keto-3-deoxygluconate permease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -232
score = 5.76988
sequence = AACTAAAACATTGTTTTATTT

Gene: Ent638_0314: 2-keto-3-deoxygluconate permease
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4124: 2-keto-3-deoxygluconate permease
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-keto-3-deoxygluconate permease
 
CRON 27.
pelC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*3
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -102
score = 4.52376
sequence = CAATAAACCTTGATTTCATTT

Site:
position = -289
score = 5.39179
sequence = AAACGAAATATAATTTTATTT

Gene: ECA4069: Pectate lyase B precursor (EC 4.2.2.2)

Gene: ECA4068: Pectate lyase B precursor (EC 4.2.2.2)

Site:
position = -77
score = 4.09667
sequence = TGTTGAAACAGCCATTTTATT

Site:
position = -99
score = 4.52589
sequence = AGACAAACCTTAATTTCATTT

Site:
position = -231
score = 4.21069
sequence = AAATAGAAATCAGTTTCTATT

Gene: ECA4067: Pectate lyase B precursor (EC 4.2.2.2)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Pectate lyase B precursor (EC 4.2.2.2)
pelZ
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -2
score = 4.0931
sequence = AAATGAAACGTTCTCTTCTGT

Gene: ECA4070: pectate lyase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
COG3866 Pectate lyase
 
CRON 28.
pelX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -60
score = 5.67677
sequence = AAAAGAAACGACGTTTCATCT

Site:
position = -102
score = 5.23501
sequence = AAGCAAAACAACGTTTTAATT

Gene: Ent638_4134: Pectate disaccharide-lyase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -66
score = 5.96787
sequence = AAAAGAAACAGCGTTTCATTT

Site:
position = -113
score = 4.19447
sequence = ATAAAAAACAGACTTTATTTT

Site:
position = -130
score = 5.30977
sequence = AAATGACACGGTGTTTCATAA

Gene: ECA4510: Pectate disaccharide-lyase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Pectate disaccharide-lyase
 
CRON 29.
kdgR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1827: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Salmonella typhimurium LT2

Gene: STM1842: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01146: 2-keto-3-deoxy-D-gluconate repressor, IclR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -161
score = 5.04145
sequence = AAATGAAACGGTTTTTTGAAT

Gene: KPN_02343: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Enterobacter sp. 638

Gene: Ent638_2397: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -76
score = 4.7252
sequence = AATAAAACCATTGTTCTATTT

Gene: y1876: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Serratia proteamaculans 568

Gene: Spro_2122: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2425: 2-keto-3-deoxy-D-gluconate repressor, IclR family
*
Edwardsiella tarda EIB202

Site:
position = -46
score = 4.75787
sequence = TACTGAAACAGAGGTTCGTTT

Gene: ETAE_1567: 2-keto-3-deoxy-D-gluconate repressor, IclR family
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-keto-3-deoxy-D-gluconate repressor, IclR family
 
CRON 30.
ECA2137
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*2
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2136: putative exported protein

Site:
position = -349
score = 5.19474
sequence = AAATGAAACAATGCTTCCTTT

Gene: ECA2137: putative exported protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative exported protein
pelP
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_0482: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3834: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2135: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Exopolygalacturonate lyase (EC 4.2.2.9)
aslB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3226: chondro-6-sulfatase
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -70
score = 5.32845
sequence = ATAAGAAACATCGTTTTAAAT

Gene: ETAE_2529: chondro-6-sulfatase
 
Proteus mirabilis HI4320

Gene: PMI2142: chondro-6-sulfatase
 
Photorhabdus luminescens subsp. laumondii TTO1
chondro-6-sulfatase
ETAE_2528
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3227: putative sulfatase
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2528: putative sulfatase
 
Proteus mirabilis HI4320

Gene: PMI2143: putative sulfatase
 
Photorhabdus luminescens subsp. laumondii TTO1
putative sulfatase
ETAE_2527
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3228: hypothetical protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2527: hypothetical protein
 
Proteus mirabilis HI4320

Gene: PMI2144: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
kdgM
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -37
score = 5.59943
sequence = AAACGAAATGTCATTTTATTT

Site:
position = -58
score = 5.75266
sequence = AAATAAAATGATGTTTCATAA

Gene: KPN_03267: Oligogalacturonate-specific porin protein KdgM
*2
Enterobacter sp. 638

Site:
position = -33
score = 5.41649
sequence = AAACGAAATGACATTTTAATT

Site:
position = -54
score = 4.91971
sequence = AAATAAAATGCAGTTCCATAA

Gene: Ent638_3298: Oligogalacturonate-specific porin protein KdgM

Site:
position = -304
score = 4.93631
sequence = TCTCAAAACATCATTTCATTT

Gene: Ent638_0483: Oligogalacturonate-specific porin protein KdgM
 
Erwinia amylovora ATCC 49946
*2
Yersinia pestis KIM

Site:
position = -103
score = 5.40329
sequence = AAATGAAACATTGCTTCTTTT

Gene: y1880: Oligogalacturonate-specific porin protein KdgM

Site:
position = -75
score = 5.74237
sequence = AAATAAAATACTGTTTCATAA

Gene: y3833: Oligogalacturonate-specific porin protein KdgM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -153
score = 4.79515
sequence = ATTTGAAACCCTATTTTACTT

Gene: ECA2407: Oligogalacturonate-specific porin protein KdgM
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Oligogalacturonate-specific porin protein KdgM
tpfX
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -231
score = 5.35913
sequence = TTATGAAACATTGTTTCAGAT

Gene: STM1931: ThiJ/PfpI-family hypothetical protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -199
score = 5.40986
sequence = TTTTGAAATGATGTTTCATAT

Gene: CKO_01049: ThiJ/PfpI-family hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -42
score = 5.0274
sequence = GGATGAAACGCTGTTTTAAAT

Gene: Ent638_2477: ThiJ/PfpI-family hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -85
score = 6.13996
sequence = TAATAAAACATCGTTTCATTT

Gene: ECA0102: ThiJ/PfpI-family hypothetical protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ThiJ/PfpI-family hypothetical protein
 
CRON 31.
dhfX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0507: putative exported protein
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -32
score = 5.94697
sequence = AAAAGAAACGATGTTTTATTT

Gene: ECA3785: putative exported protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative exported protein
 
CRON 32.
setC
 2
Escherichia coli str. K-12 substr. MG1655

Gene: b2170: lactose/glucose efflux system

Gene: b3659: lactose/glucose efflux system
 
Salmonella typhimurium LT2

Gene: STM2207: lactose/glucose efflux system
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00612: lactose/glucose efflux system
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -102
score = 5.00651
sequence = TTTTGAAACGCCTTTTTAATT

Gene: KPN_02601: lactose/glucose efflux system
*
Enterobacter sp. 638

Site:
position = -109
score = 4.91445
sequence = TTTTGAAATGCTATTTTGATT

Gene: Ent638_2764: lactose/glucose efflux system
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3234: lactose/glucose efflux system
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -88
score = 4.97518
sequence = TAATGAAACAAGATTTCTGTT

Gene: ECA2730: lactose/glucose efflux system
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
lactose/glucose efflux system
 
CRON 33.
eda
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -359
score = 4.47851
sequence = TATTGGACCGGTGTTTCAAAA

Gene: b1850: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
*
Salmonella typhimurium LT2

Site:
position = -360
score = 4.45176
sequence = TATTGGACCGCCGTTTCAAAA

Gene: STM1884: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -360
score = 4.51554
sequence = TATTGGACCGTTGTTTCAAAA

Gene: CKO_01116: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -361
score = 4.45176
sequence = TATTGGACCGCCGTTTCAAAA

Gene: KPN_02365: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
*
Enterobacter sp. 638

Site:
position = -362
score = 4.47851
sequence = TATTGGACCGCTGTTTCAAAA

Gene: Ent638_2419: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2243: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 2
Serratia proteamaculans 568

Gene: Spro_2767: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)

Gene: Spro_4500: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2478: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Edwardsiella tarda EIB202

Gene: ETAE_1452: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Proteus mirabilis HI4320

Gene: PMI2761: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Photorhabdus luminescens subsp. laumondii TTO1
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD