Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CcpN - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 2
Bacillus amyloliquefaciens FZB42 2 2
Bacillus pumilus SAFR-032 2 2
Bacillus licheniformis DSM 13 2 2
Anoxybacillus flavithermus WK1 2 2
Geobacillus kaustophilus HTA426 2 2
Bacillus cereus ATCC 14579 2 2
Bacillus halodurans C-125 2 2
Bacillus clausii KSM-K16 2 2
Oceanobacillus iheyensis HTE831 2 2
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pckA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -61
score = 5.05843
sequence = AATATATGTTATACTAATTCA

Gene: BSU30560: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -63
score = 4.65162
sequence = GATATATGTTATACTAATTCC

Gene: RBAM_027580: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus pumilus SAFR-032

Site:
position = -58
score = 4.60502
sequence = TGAATGTGTTATACTAATCGA

Gene: BPUM_2687: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus licheniformis DSM 13

Site:
position = -67
score = 5.39027
sequence = TAAATGTGTTATACTAATTCT

Site:
position = -45
score = 4.34279
sequence = CATTAATGTTATACACATTAA

Gene: BLi03197: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Anoxybacillus flavithermus WK1

Site:
position = 28
score = 4.97728
sequence = AAAATGTGTTATACTTTTTAC

Gene: Aflv_0413: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Geobacillus kaustophilus HTA426

Site:
position = -55
score = 5.17161
sequence = AAAATGTGTTATACTATTTTC

Gene: GK2850: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus cereus ATCC 14579

Site:
position = -69
score = 4.82944
sequence = TAATTGTGTTATACTCTTGTT

Gene: BC4762: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus halodurans C-125

Site:
position = -60
score = 5.29782
sequence = TAAATGTGTTATACTAAATAA

Gene: BH3302: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Bacillus clausii KSM-K16

Site:
position = -51
score = 4.64983
sequence = AAAATGTGTTATACTAAAGCC

Gene: ABC2879: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
*
Oceanobacillus iheyensis HTE831

Site:
position = -88
score = 5.32513
sequence = TTAATGTGTTATACTAATAAT

Gene: OB2315: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
 
Paenibacillus sp. JDR-2
Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
 
CRON 2.
gapB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -67
score = 5.51132
sequence = TTAATGTGTTATACTAATTTT

Gene: BSU29020: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -68
score = 5.11257
sequence = TTAATGTGTTATACTATATAT

Gene: RBAM_026060: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus pumilus SAFR-032

Site:
position = -69
score = 4.44113
sequence = CTAATGTGATATACTAATTTC

Site:
position = -38
score = 5.13827
sequence = TTATTGAGTATAACACATAAT

Gene: BPUM_2547: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus licheniformis DSM 13

Site:
position = -68
score = 5.36347
sequence = ATAATGTGTTATACTTATTTT

Gene: BLi03052: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Anoxybacillus flavithermus WK1

Site:
position = -38
score = 5.18002
sequence = ATAAATAGTATAACACATATA

Site:
position = -70
score = 5.01773
sequence = TAAAAATGTTATACTATTTTT

Gene: Aflv_0514: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Geobacillus kaustophilus HTA426

Site:
position = -69
score = 4.78072
sequence = AAAATATGATATACTATTTAT

Site:
position = -38
score = 4.36391
sequence = GAAAATAGTATAACATATATG

Gene: GK2726: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus cereus ATCC 14579

Site:
position = -37
score = 4.70343
sequence = ATAAATAGTATAACGCATTCA

Site:
position = -68
score = 4.8268
sequence = TTTTTGTGTTATACTATTATT

Gene: BC4583: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus halodurans C-125

Site:
position = -66
score = 4.76365
sequence = TAAAAGTGATATACTATTTAT

Gene: BH3149: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Bacillus clausii KSM-K16

Site:
position = -71
score = 4.67095
sequence = TATTTATGTTATACTATTTCA

Gene: ABC2705: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
*
Oceanobacillus iheyensis HTE831

Site:
position = -36
score = 4.38071
sequence = GTTATGAGTATATCATAATTA

Site:
position = -66
score = 5.17571
sequence = AATTTGTGTTATACTAATTAT

Gene: OB2160: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
 
Paenibacillus sp. JDR-2
NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD