Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AcoR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: Fis
Regulation mode: activator
Biological process: Acetoin utilization
Effector: Acetoin
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 4 1
Bacillus amyloliquefaciens FZB42 4 1
Bacillus pumilus SAFR-032 4 1
Bacillus licheniformis DSM 13 1 1
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579 4 1
Bacillus halodurans C-125 4 1
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acoA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -129
score = 8.04023
sequence = GACAAAACGAGACACACGTCTCAAACTGTCTC

Gene: BSU08060: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -129
score = 8.14341
sequence = GACAAAATGAGACACCTGTCTCAAACTGTCTC

Gene: RBAM_008300: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
*
Bacillus pumilus SAFR-032

Site:
position = -140
score = 7.73186
sequence = GACAAATAGAGATTCAAGTCTCATTTTGTCTC

Gene: BPUM_0451: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
*
Bacillus licheniformis DSM 13

Site:
position = -140
score = 7.99839
sequence = GACAAATTGAGACATCTGTCTCGTTTTGTCTC

Gene: BLi00849: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -135
score = 7.78856
sequence = GACAAAACGAGACAAATGTCTCATTTTGTCCA

Gene: BC2779: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
*
Bacillus halodurans C-125

Site:
position = -141
score = 5.67281
sequence = GACAATGTGAGACGTAACAGTGTTGCTAGTTT

Gene: BH1822: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
 
Bacillus clausii KSM-K16

Gene: ABC2786: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-)
acoB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08070: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_008310: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0452: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Bacillus licheniformis DSM 13

Gene: BLi00850: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2778: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Bacillus halodurans C-125

Gene: BH1823: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Bacillus clausii KSM-K16

Gene: ABC2785: Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Acetoin dehydrogenase E1 component beta-subunit (EC 1.2.4.-)
acoC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08080: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_008320: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0453: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Bacillus licheniformis DSM 13

Gene: BLi00851: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2777: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Bacillus halodurans C-125

Gene: BH1824: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Bacillus clausii KSM-K16

Gene: ABC2784: Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Dihydrolipoamide acetyltransferase component (E2) of acetoin dehydrogenase complex (EC 2.3.1.-)
acoL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08090: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_008330: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0454: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Bacillus licheniformis DSM 13

Gene: BLi00852: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2776: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Bacillus halodurans C-125

Gene: BH1825: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Bacillus clausii KSM-K16

Gene: ABC2787: Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Dihydrolipoamide dehydrogenase of acetoin dehydrogenase (EC 1.8.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD