Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhhR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1 5 3
Pseudomonas entomophila L48 4 2
Pseudomonas fluorescens Pf-5 4 2
Pseudomonas mendocina ymp 9 3
Pseudomonas putida KT2440 3 2
Pseudomonas stutzeri A1501 9 3
Pseudomonas syringae pv. tomato str. DC3000 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phhR
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -159
score = 5.46702
sequence = TCGTAAAGTTTTCCTTACGA

Site:
position = -86
score = 5.21705
sequence = CTGTCACATATTCTTGACGG

Gene: PA0873: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas entomophila L48

Site:
position = -138
score = 5.41991
sequence = TTGTAACGATAATTTTACAA

Site:
position = -65
score = 5.21598
sequence = TTGTCAGCTTATCTTTACGA

Gene: PSEEN3891: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas fluorescens Pf-5

Site:
position = -194
score = 5.54307
sequence = TTGTAAAGTAAACGTTACGA

Site:
position = -120
score = 5.28101
sequence = CTGTCACATAATCTTGACGA

Gene: PFL_1612: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas mendocina ymp

Site:
position = -80
score = 5.21705
sequence = CTGTCACATATTCTTGACGG

Gene: Pmen_3111: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas putida KT2440

Site:
position = -138
score = 5.4012
sequence = TCGTAACGATAATTTTACAA

Site:
position = -65
score = 5.21598
sequence = TTGTCAGCTTATCTTTACGA

Gene: PP4489: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas stutzeri A1501

Site:
position = -136
score = 4.89218
sequence = CTGTAAGAAATACATGACAG

Site:
position = -74
score = 5.36784
sequence = CTGTCAAATAATCTTGACGA

Gene: PST_3561: Phenylalanine degradation transcriptional activator, TyrR family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -88
score = 4.87066
sequence = GTGTAACGTATTGTTGACGG

Site:
position = -161
score = 5.50565
sequence = TCGTAACGAAAACTTTACGA

Gene: PSPTO1823: Phenylalanine degradation transcriptional activator, TyrR family
Phenylalanine degradation transcriptional activator, TyrR family
 
CRON 2.
hpd
 
Azotobacter vinelandii AvOP

Gene: Avin_34750: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Pseudomonas aeruginosa PAO1

Site:
position = -161
score = 4.40565
sequence = GCGTAAGGAATAGTTGCCAG

Site:
position = -212
score = 5.56592
sequence = CTGTAAAGATAACTTTACGA

Gene: PA0865: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -144
score = 4.86282
sequence = CTGTAAGAAAAACTTGCCAA

Site:
position = -195
score = 4.66598
sequence = CTGGCAAGAAAACCTTACGC

Gene: Pmen_1696: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Pseudomonas putida KT2440
*
Pseudomonas stutzeri A1501

Site:
position = -143
score = 5.24164
sequence = CTGTAAGGAAAACCTGACAG

Site:
position = -203
score = 4.75455
sequence = CTGTCAGCTTTTCGTTACGC

Gene: PST_0869: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Pseudomonas syringae pv. tomato str. DC3000
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1697: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_0870: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Pseudomonas syringae pv. tomato str. DC3000
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1698: Fumarylacetoacetase (EC 3.7.1.2)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_0871: Fumarylacetoacetase (EC 3.7.1.2)
 
Pseudomonas syringae pv. tomato str. DC3000
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1699: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_0872: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Pseudomonas syringae pv. tomato str. DC3000
Maleylacetoacetate isomerase (EC 5.2.1.2)
COG0733
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1700: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_0873: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
 
Pseudomonas syringae pv. tomato str. DC3000
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
 
CRON 3.
phhA
 
Azotobacter vinelandii AvOP

Gene: Avin_34650: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas aeruginosa PAO1

Site:
position = -217
score = 5.21705
sequence = CCGTCAAGAATATGTGACAG

Site:
position = -144
score = 5.46702
sequence = TCGTAAGGAAAACTTTACGA

Gene: PA0872: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas entomophila L48

Site:
position = -210
score = 5.21598
sequence = TCGTAAAGATAAGCTGACAA

Site:
position = -137
score = 5.41991
sequence = TTGTAAAATTATCGTTACAA

Gene: PSEEN3892: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas fluorescens Pf-5

Site:
position = -207
score = 5.28101
sequence = TCGTCAAGATTATGTGACAG

Site:
position = -133
score = 5.54307
sequence = TCGTAACGTTTACTTTACAA

Gene: PFL_1611: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas mendocina ymp

Site:
position = -193
score = 5.21705
sequence = CCGTCAAGAATATGTGACAG

Gene: Pmen_3112: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas putida KT2440

Site:
position = -212
score = 5.21598
sequence = TCGTAAAGATAAGCTGACAA

Site:
position = -139
score = 5.4012
sequence = TTGTAAAATTATCGTTACGA

Gene: PP4490: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas stutzeri A1501

Site:
position = -191
score = 5.36784
sequence = TCGTCAAGATTATTTGACAG

Site:
position = -129
score = 4.89218
sequence = CTGTCATGTATTTCTTACAG

Gene: PST_3562: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -206
score = 4.87066
sequence = CCGTCAACAATACGTTACAC

Site:
position = -133
score = 5.50565
sequence = TCGTAAAGTTTTCGTTACGA

Gene: PSPTO1822: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Azotobacter vinelandii AvOP

Gene: Avin_34660: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas aeruginosa PAO1

Gene: PA0871: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas entomophila L48

Gene: PSEEN3893: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1610: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas mendocina ymp

Gene: Pmen_3113: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas putida KT2440

Gene: PP4491: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas stutzeri A1501

Gene: PST_3563: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1821: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhC
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA0870: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
 
Pseudomonas entomophila L48

Gene: PSEEN3894: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1609: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
 
Pseudomonas mendocina ymp

Gene: Pmen_3114: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501

Gene: PST_3564: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
 
Pseudomonas syringae pv. tomato str. DC3000
Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD