Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdpR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Toxin-antitoxin system
Effector: SdpI, signal transduction protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 1
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 2 1
Anoxybacillus flavithermus WK1 2 1
Geobacillus kaustophilus HTA426 2 1
Bacillus cereus ATCC 14579 2 1
Bacillus halodurans C-125 2 1
Bacillus clausii KSM-K16 2 1
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sdpR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -53
score = 6.19685
sequence = ATTTATACAAATATCTAAAT

Gene: BSU33790: Transcriptional regulator of SdpC resistance operon
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -42
score = 6.28889
sequence = ATTTAGTTAAATAACTAAAT

Gene: BLi00787: Transcriptional regulator of SdpC resistance operon
*
Anoxybacillus flavithermus WK1

Site:
position = -71
score = 6.06786
sequence = AATTAGAAATTTGTCTAAAT

Site:
position = -32
score = 6.41475
sequence = ATTTAGAAATTTGTCTAAAT

Gene: Aflv_1587: Transcriptional regulator of SdpC resistance operon
*
Geobacillus kaustophilus HTA426

Site:
position = -148
score = 5.42742
sequence = ATTTAGATGTTTTTCTAAAC

Gene: GK2134: Transcriptional regulator of SdpC resistance operon
*
Bacillus cereus ATCC 14579

Site:
position = -47
score = 6.07054
sequence = GTTTAGATAAATATCTAAAT

Gene: BC4834: Transcriptional regulator of SdpC resistance operon
*
Bacillus halodurans C-125

Site:
position = -42
score = 5.8714
sequence = ATTTAAGTAATTGCTTAAAT

Gene: BH0945: Transcriptional regulator of SdpC resistance operon
*
Bacillus clausii KSM-K16

Site:
position = -54
score = 5.5878
sequence = ATTTAAGTAATTTCTTAATT

Gene: ABC3711: Transcriptional regulator of SdpC resistance operon
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -54
score = 6.35878
sequence = ATTTAGAATATTATCTAAAT

Gene: Pjdr2_5471: Transcriptional regulator of SdpC resistance operon
Transcriptional regulator of SdpC resistance operon
sdpI
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33780: Integral membrane SdpC antitoxin
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00786: Integral membrane SdpC antitoxin
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1586: Integral membrane SdpC antitoxin
 
Geobacillus kaustophilus HTA426

Gene: GK2133: Integral membrane SdpC antitoxin
 
Bacillus cereus ATCC 14579

Gene: BC4833: Integral membrane SdpC antitoxin
 
Bacillus halodurans C-125

Gene: BH0946: Integral membrane SdpC antitoxin
 
Bacillus clausii KSM-K16

Gene: ABC3712: Integral membrane SdpC antitoxin
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5470: Integral membrane SdpC antitoxin
Integral membrane SdpC antitoxin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD