Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzrA - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 3 2
Bacillus amyloliquefaciens FZB42 3 2
Bacillus pumilus SAFR-032 1 1
Bacillus licheniformis DSM 13 2 2
Anoxybacillus flavithermus WK1 2 1
Geobacillus kaustophilus HTA426 5 2
Bacillus cereus ATCC 14579 3 2
Bacillus halodurans C-125
Bacillus clausii KSM-K16 2 1
Oceanobacillus iheyensis HTE831 2 1
Paenibacillus sp. JDR-2 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czrA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU19120: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018890: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Bacillus pumilus SAFR-032

Gene: BPUM_1843: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Bacillus licheniformis DSM 13

Gene: BLi02201: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Anoxybacillus flavithermus WK1

Site:
position = -41
score = 7.23713
sequence = TATATGAACATATATTCATATA

Gene: Aflv_1335: Transcriptional repressor of multiple metal-sensing, ArsR family
*2
Geobacillus kaustophilus HTA426

Site:
position = -43
score = 7.07801
sequence = TATATGAACAAATGCTCATATA

Gene: GK1406: Transcriptional repressor of multiple metal-sensing, ArsR family

Site:
position = -48
score = 7.00209
sequence = CATATGAACATATGCTCATATA

Gene: GK0580: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Bacillus cereus ATCC 14579

Site:
position = -46
score = 5.74008
sequence = TATATGAatgatTGtTCATATg

Gene: BC0595: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -36
score = 6.83508
sequence = AATATGAACATATAATCATATA

Gene: ABC3390: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Oceanobacillus iheyensis HTE831

Site:
position = -39
score = 6.71542
sequence = AATATGAGCATATGATCATATT

Gene: OB1400: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1132: Transcriptional repressor of multiple metal-sensing, ArsR family
Transcriptional repressor of multiple metal-sensing, ArsR family
czcD
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -116
score = 7.1249
sequence = TATATGAACACATGCTCATATA

Gene: BSU26650: Cation diffusion facilitator family transporter
*2
Bacillus amyloliquefaciens FZB42

Site:
position = -87
score = 7.27754
sequence = TATATGAGTATATGTTCATATA

Gene: RBAM_030670: Cation diffusion facilitator family transporter

Site:
position = -106
score = 6.88294
sequence = TATATGAGCACATAATCATATA

Gene: RBAM_005600: Cation diffusion facilitator family transporter
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -45
score = 6.58461
sequence = AATATGAATACATGATCATATA

Gene: BLi03452: Cation diffusion facilitator family transporter
 
Anoxybacillus flavithermus WK1
 2
Geobacillus kaustophilus HTA426

Gene: GK1407: Cation diffusion facilitator family transporter

Gene: GK0581: Cation diffusion facilitator family transporter
 2
Bacillus cereus ATCC 14579

Gene: BC0596: Cation diffusion facilitator family transporter

Gene: BC1701: Cation diffusion facilitator family transporter
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC3389: Cation diffusion facilitator family transporter
 
Oceanobacillus iheyensis HTE831

Gene: OB1399: Cation diffusion facilitator family transporter
*
Paenibacillus sp. JDR-2

Site:
position = -44
score = 6.07141
sequence = CATATGAATAGTTGTTCATATA

Gene: Pjdr2_0376: Cation diffusion facilitator family transporter
Cation diffusion facilitator family transporter
czcO
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU26640: CzcD accessory protein (oxidoreductase)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_005610: CzcD accessory protein (oxidoreductase)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK0582: CzcD accessory protein (oxidoreductase)
*
Bacillus cereus ATCC 14579

Site:
position = -44
score = 6.03743
sequence = TATATGAACAAATATTCATACG

Gene: BC3447: CzcD accessory protein (oxidoreductase)
 
Bacillus halodurans C-125

Gene: BH3677: CzcD accessory protein (oxidoreductase)
 
Bacillus clausii KSM-K16

Gene: ABC0270: CzcD accessory protein (oxidoreductase)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
CzcD accessory protein (oxidoreductase)
cadA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -94
score = 7.31796
sequence = TATATGAGTATATGCTCATATA

Gene: BSU33490: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -87
score = 7.27754
sequence = TATATGAATATATGCTCATATA

Gene: BPUM_3010: Cadmium-transporting ATPase (EC 3.6.3.3)
*
Bacillus licheniformis DSM 13

Site:
position = -61
score = 6.92436
sequence = TATATGCGTATATGCTCATATA

Gene: BLi03539: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1336: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0269: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -41
score = 6.72972
sequence = TATATGAGCAAGTATTCATATA

Gene: Pjdr2_1130: Cadmium-transporting ATPase (EC 3.6.3.3)
Cadmium-transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD