Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AseR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 1
Bacillus amyloliquefaciens FZB42 2 1
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 2 1
Anoxybacillus flavithermus WK1 3 1
Geobacillus kaustophilus HTA426 6 2
Bacillus cereus ATCC 14579
Bacillus halodurans C-125 3 1
Bacillus clausii KSM-K16 3 1
Oceanobacillus iheyensis HTE831 3 1
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aseR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -191
score = 6.26364
sequence = TATATAAATAAAAGTTTATATA

Site:
position = -46
score = 6.79954
sequence = TATATAACGATTTGCTTATATA

Gene: BSU05330: Transcriptional regulator of arsenic resistance, ArsR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -46
score = 6.88864
sequence = TATATAAACATCTGCTTATATA

Gene: RBAM_035850: Transcriptional regulator of arsenic resistance, ArsR family
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02124: Transcriptional regulator of arsenic resistance, ArsR family
*
Anoxybacillus flavithermus WK1

Site:
position = -50
score = 6.79612
sequence = CATATAAGTATATGATTATATA

Gene: Aflv_1412: Transcriptional regulator of arsenic resistance, ArsR family
*2
Geobacillus kaustophilus HTA426

Site:
position = -124
score = 6.82597
sequence = TATATAAGTACTTAATTATATA

Site:
position = -42
score = 5.86234
sequence = TATATAAGCAAATCATGATATG

Gene: GK3224: Transcriptional regulator of arsenic resistance, ArsR family

Site:
position = -212
score = 6.93147
sequence = TATATAAGTATGTAGTTATATA

Site:
position = -48
score = 6.49665
sequence = TATATAAGTAAATAACTATATA

Gene: GK0587: Transcriptional regulator of arsenic resistance, ArsR family
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -55
score = 7.18142
sequence = TATATAAGTATATGTTTATATA

Gene: BH3000: Transcriptional regulator of arsenic resistance, ArsR family
*
Bacillus clausii KSM-K16

Site:
position = -66
score = 6.94129
sequence = TATATTAGCATTTACTTATATA

Gene: ABC0835: Transcriptional regulator of arsenic resistance, ArsR family
*
Oceanobacillus iheyensis HTE831

Site:
position = -60
score = 5.99493
sequence = AACATAAGCATTGACTTATATA

Site:
position = -44
score = 7.35449
sequence = TATATAAGCAAATGCTTATATA

Gene: OB2425: Transcriptional regulator of arsenic resistance, ArsR family
 
Paenibacillus sp. JDR-2
Transcriptional regulator of arsenic resistance, ArsR family
aseA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU05340: Arsenic efflux pump protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035860: Arsenic efflux pump protein
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -79
score = 6.55599
sequence = AATATAAGCATTGACTTATATA

Gene: BLi02123: Arsenic efflux pump protein
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1413: Arsenic efflux pump protein
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2999: Arsenic efflux pump protein
 
Bacillus clausii KSM-K16

Gene: ABC0836: Arsenic efflux pump protein
 
Oceanobacillus iheyensis HTE831

Gene: OB2424: Arsenic efflux pump protein
 
Paenibacillus sp. JDR-2
Arsenic efflux pump protein
arsC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU25780: Arsenate reductase (EC 1.20.4.1)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02122: Arsenate reductase (EC 1.20.4.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1414: Arsenate reductase (EC 1.20.4.1)
 2
Geobacillus kaustophilus HTA426

Gene: GK3222: Arsenate reductase (EC 1.20.4.1)

Gene: GK0589: Arsenate reductase (EC 1.20.4.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2998: Arsenate reductase (EC 1.20.4.1)
 
Bacillus clausii KSM-K16

Gene: ABC0837: Arsenate reductase (EC 1.20.4.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2423: Arsenate reductase (EC 1.20.4.1)
 
Paenibacillus sp. JDR-2
Arsenate reductase (EC 1.20.4.1)
arsB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU25790: Arsenite efflux transporter
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 2
Geobacillus kaustophilus HTA426

Gene: GK3223: Arsenite efflux transporter

Gene: GK0588: Arsenite efflux transporter
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arsenite efflux transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD