Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 265 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 30 26
Salmonella typhimurium LT2 32 27
Citrobacter koseri ATCC BAA-895 22 21
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 27 22
Enterobacter sp. 638 27 23
Erwinia amylovora ATCC 49946 22 19
Yersinia pestis KIM 17 15
Serratia proteamaculans 568 18 16
Erwinia carotovora subsp. atroseptica SCRI1043 17 15
Edwardsiella tarda EIB202 18 15
Proteus mirabilis HI4320 20 16
Photorhabdus luminescens subsp. laumondii TTO1 16 15
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
umuD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -39
score = 6.0539
sequence = TACTGTATATAAAAACAGTA

Gene: b1183: DNA polymerase V, subunit UmuD
*
Salmonella typhimurium LT2

Site:
position = -35
score = 6.0539
sequence = TACTGTATATAAAAACAGTA

Gene: STM1998: DNA polymerase V, subunit UmuD
*
Citrobacter koseri ATCC BAA-895

Site:
position = -38
score = 5.89186
sequence = TACTGTATATATAATCAGTA

Gene: CKO_01842: DNA polymerase V, subunit UmuD
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -40
score = 5.8081
sequence = TACTGTATATAAAAACAGTG

Gene: KPN_01438: DNA polymerase V, subunit UmuD
*
Enterobacter sp. 638

Site:
position = -34
score = 5.93694
sequence = TACTGTATGTAAAAACAGTA

Gene: Ent638_2213: DNA polymerase V, subunit UmuD
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -47
score = 6.14366
sequence = TACTGTATAAATAAACAGTA

Gene: PMI2484: DNA polymerase V, subunit UmuD
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA polymerase V, subunit UmuD
umuC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1184: DNA polymerase V, subunit UmuC
 
Salmonella typhimurium LT2

Gene: STM1997: DNA polymerase V, subunit UmuC
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01841: DNA polymerase V, subunit UmuC
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01439: DNA polymerase V, subunit UmuC
 
Enterobacter sp. 638

Gene: Ent638_2212: DNA polymerase V, subunit UmuC
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2485: DNA polymerase V, subunit UmuC
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA polymerase V, subunit UmuC
 
CRON 2.
sulA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -42
score = 5.58938
sequence = TACTGTACATCCATACAGTA

Gene: b0958: Cell division inhibitor sulA
*
Salmonella typhimurium LT2

Site:
position = -41
score = 6.17771
sequence = TACTGTATGAATATACAGTA

Gene: STM1071: Cell division inhibitor sulA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -41
score = 6.02504
sequence = TACTGTATATCCATACAGTA

Gene: CKO_02110: Cell division inhibitor sulA
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -39
score = 5.97269
sequence = TACTGTATATGCATACAGTA

Gene: KPN_00987: Cell division inhibitor sulA
*
Enterobacter sp. 638

Site:
position = -34
score = 6.17771
sequence = TACTGTATATTCATACAGTA

Gene: Ent638_1470: Cell division inhibitor sulA
*
Erwinia amylovora ATCC 49946

Site:
position = -40
score = 5.6787
sequence = TACTGTATATCCATACAGTC

Gene: EAM_1378: Cell division inhibitor sulA
*
Yersinia pestis KIM

Site:
position = -39
score = 6.05196
sequence = TACTGTATATACATACAGCA

Gene: y2734: Cell division inhibitor sulA
*
Serratia proteamaculans 568

Site:
position = -41
score = 5.93191
sequence = TACTGTATAAACATACAGTG

Gene: Spro_1755: Cell division inhibitor sulA
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -41
score = 6.06075
sequence = TACTGTATGTTCATACAGTA

Gene: ECA1752: Cell division inhibitor sulA
*
Edwardsiella tarda EIB202

Site:
position = -115
score = 5.86477
sequence = TACTGTATAAGCATACAGTA

Gene: ETAE_1269: Cell division inhibitor sulA
*
Proteus mirabilis HI4320

Site:
position = -39
score = 6.28564
sequence = TACTGTATATACATACAGTA

Gene: PMI0786: Cell division inhibitor sulA
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -40
score = 5.9691
sequence = TACTGTATATTAATACAGTT

Gene: plu1776: Cell division inhibitor sulA
Cell division inhibitor sulA
 
CRON 3.
uvrD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -76
score = 4.88221
sequence = ATCTGTATATATACCCAGCT

Gene: b3813: ATP-dependent DNA helicase II
*
Salmonella typhimurium LT2

Site:
position = -125
score = 4.76243
sequence = TTCTGTATAAATTCCCAGTT

Gene: STM3951: ATP-dependent DNA helicase II
*
Citrobacter koseri ATCC BAA-895

Site:
position = -76
score = 5.0196
sequence = TATTGTATATATACCCAGCT

Gene: CKO_00155: ATP-dependent DNA helicase II
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -53
score = 4.6323
sequence = CTCTGTATATATTAACAGGG

Gene: KPN_04312: ATP-dependent DNA helicase II
*
Enterobacter sp. 638

Site:
position = -68
score = 5.1075
sequence = TATTGTATAAATCAACAGTA

Gene: Ent638_3979: ATP-dependent DNA helicase II
*
Erwinia amylovora ATCC 49946

Site:
position = -55
score = 4.95805
sequence = ACCTGGTTATTTAACCAGTG

Gene: EAM_0187: ATP-dependent DNA helicase II
*
Yersinia pestis KIM

Site:
position = -82
score = 4.73719
sequence = CCCTGTGTAAATCTACAGTG

Gene: y0389: ATP-dependent DNA helicase II
*
Serratia proteamaculans 568

Site:
position = -56
score = 4.39871
sequence = CTCTGTATAAATTCCCAGTG

Gene: Spro_0186: ATP-dependent DNA helicase II
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -71
score = 4.51219
sequence = ATCTGTATAAATCACCAGTG

Gene: ECA4179: ATP-dependent DNA helicase II
*
Edwardsiella tarda EIB202

Site:
position = -65
score = 5.03689
sequence = TTCTGTATAAATCTCCAGTA

Gene: ETAE_0126: ATP-dependent DNA helicase II
*
Proteus mirabilis HI4320

Site:
position = -47
score = 5.05575
sequence = TTCTGTATATATCCACAGTA

Gene: PMI3340: ATP-dependent DNA helicase II
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -55
score = 5.0445
sequence = TTCTGTATAAAAACACAGCA

Gene: plu4636: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 4.
recA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -79
score = 5.74781
sequence = TACTGTATGAGCATACAGTA

Gene: b2699: Recombinase A
*
Salmonella typhimurium LT2

Site:
position = -84
score = 5.74781
sequence = TACTGTATGAGCATACAGTA

Gene: STM2829: Recombinase A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -96
score = 5.48145
sequence = TACTGTATGACTGTACAGTA

Gene: CKO_04050: Recombinase A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -90
score = 5.80015
sequence = TACTGTATGACCATACAGTA

Gene: KPN_03031: Recombinase A
*
Enterobacter sp. 638

Site:
position = -92
score = 5.91711
sequence = TACTGTATGACTATACAGTA

Gene: Ent638_3174: Recombinase A
*
Erwinia amylovora ATCC 49946

Site:
position = -88
score = 6.06979
sequence = TACTGTATGATTATACAGTA

Gene: EAM_2640: Recombinase A
*2
Yersinia pestis KIM

Gene: Y1113: Recombinase A

Site:
position = -102
score = 5.63413
sequence = TACTGTATGATTGTACAGTA

Gene: y0881: Recombinase A
*
Serratia proteamaculans 568

Site:
position = -100
score = 5.80015
sequence = TACTGTATGACCATACAGTA

Gene: Spro_0841: Recombinase A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -101
score = 5.73902
sequence = TGCTGTATGTGTATACAGTA

Gene: ECA3369: Recombinase A
*
Edwardsiella tarda EIB202

Site:
position = -63
score = 5.74781
sequence = TACTGTATGAGCATACAGTA

Gene: ETAE_2861: Recombinase A
*
Proteus mirabilis HI4320

Site:
position = -102
score = 6.06979
sequence = TACTGTATGATTATACAGTA

Gene: PMI0375: Recombinase A
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -100
score = 5.83612
sequence = TGCTGTATGATTATACAGTA

Gene: plu1249: Recombinase A
Recombinase A
recX
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2698: regulatory protein RecX
 
Salmonella typhimurium LT2

Gene: STM2828: regulatory protein RecX
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04049: regulatory protein RecX
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03030: regulatory protein RecX
 
Enterobacter sp. 638

Gene: Ent638_3173: regulatory protein RecX
 
Erwinia amylovora ATCC 49946

Gene: EAM_2639: regulatory protein RecX
 
Yersinia pestis KIM

Gene: y0882: regulatory protein RecX
 
Serratia proteamaculans 568

Gene: Spro_0842: regulatory protein RecX
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3368: regulatory protein RecX
 
Edwardsiella tarda EIB202

Gene: ETAE_2860: regulatory protein RecX
 
Proteus mirabilis HI4320

Gene: PMI2663: regulatory protein RecX
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3294: regulatory protein RecX
regulatory protein RecX
 
CRON 5.
dinB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -34
score = 4.75357
sequence = CACTGTATACTTTACCAGTG

Gene: b0231: DNA polymerase IV (EC 2.7.7.7)
*
Salmonella typhimurium LT2

Site:
position = -35
score = 5.39505
sequence = TACTGTACACTTAAACAGTA

Gene: STM0313: DNA polymerase IV (EC 2.7.7.7)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -35
score = 5.83071
sequence = TACTGTATACTTAAACAGTA

Gene: CKO_02960: DNA polymerase IV (EC 2.7.7.7)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = 1
score = 5.23262
sequence = TGCTGTATGGGTATACAGTG

Gene: KPN_00247: DNA polymerase IV (EC 2.7.7.7)
*
Enterobacter sp. 638

Site:
position = -37
score = 5.7696
sequence = TACTGTATACTTATCCAGTA

Gene: Ent638_0762: DNA polymerase IV (EC 2.7.7.7)
*
Erwinia amylovora ATCC 49946

Site:
position = -36
score = 5.42326
sequence = GACTGTATACTTATCCAGTA

Gene: EAM_0894: DNA polymerase IV (EC 2.7.7.7)
*
Yersinia pestis KIM

Site:
position = -41
score = 5.27383
sequence = GACTGTATACTTATACAGCT

Gene: y0959: DNA polymerase IV (EC 2.7.7.7)
*
Serratia proteamaculans 568

Site:
position = -35
score = 5.71168
sequence = GCCTGTATATTTATACAGTA

Gene: Spro_0962: DNA polymerase IV (EC 2.7.7.7)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -36
score = 5.53221
sequence = ATCTGTATATTCATACAGTA

Gene: ECA3468: DNA polymerase IV (EC 2.7.7.7)
*
Edwardsiella tarda EIB202

Site:
position = -42
score = 5.63109
sequence = TGCTGTATACTCATACAGTA

Gene: ETAE_0788: DNA polymerase IV (EC 2.7.7.7)
*
Proteus mirabilis HI4320

Site:
position = -39
score = 6.14366
sequence = TACTGTATATTTAAACAGTA

Gene: PMI0362: DNA polymerase IV (EC 2.7.7.7)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -42
score = 4.84273
sequence = TTATGTATGTTTATACAGTT

Gene: plu1239: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 6.
lexA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -47
score = 5.14368
sequence = TGCTGTATATACTCACAGCA

Site:
position = -26
score = 5.16198
sequence = AACTGTATATACACCCAGGG

Gene: b4043: LexA repressor
*
Salmonella typhimurium LT2

Site:
position = -47
score = 5.24946
sequence = AACTGTATATACTCACAGCA

Site:
position = -26
score = 4.4354
sequence = GATTGTATATACACCCAGGG

Gene: STM4237: LexA repressor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -47
score = 5.01579
sequence = AGCTGTATATACTCACAGCA

Site:
position = -26
score = 5.16198
sequence = AACTGTATATACACCCAGGG

Gene: CKO_03872: LexA repressor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -47
score = 5.01579
sequence = AGCTGTATATACTCACAGCA

Site:
position = -26
score = 5.16198
sequence = AACTGTATATACACCCAGGG

Gene: KPN_04431: LexA repressor
*
Enterobacter sp. 638

Site:
position = -47
score = 5.03101
sequence = GACTGTATATACTCACAGCA

Site:
position = -26
score = 5.16198
sequence = AACTGTATATACACCCAGGG

Gene: Ent638_0247: LexA repressor
*
Erwinia amylovora ATCC 49946

Site:
position = -46
score = 4.90015
sequence = ACCTGTATATACTCACAGTC

Site:
position = -26
score = 4.98578
sequence = GACTGTATAAACAACCAGGG

Gene: EAM_0264: LexA repressor
*
Yersinia pestis KIM

Site:
position = -47
score = 5.01579
sequence = AGCTGTATATACTCACAGCA

Site:
position = -26
score = 5.41636
sequence = AACTGTATAAACAAACAGGG

Gene: y0572: LexA repressor
*
Serratia proteamaculans 568

Site:
position = -47
score = 5.01281
sequence = ACCTGTATATACTCACAGCA

Site:
position = -26
score = 5.19791
sequence = GACTGTATAAACAAACAGGG

Gene: Spro_4460: LexA repressor
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -47
score = 5.01281
sequence = ACCTGTATATACTCACAGCA

Site:
position = -26
score = 4.98578
sequence = GACTGTATAAACAACCAGGG

Gene: ECA0630: LexA repressor
*
Edwardsiella tarda EIB202

Site:
position = -47
score = 5.01281
sequence = ACCTGTATATACTCACAGCA

Site:
position = -26
score = 4.9807
sequence = AACTGTATAAACGAACAGGG

Gene: ETAE_0230: LexA repressor
*
Proteus mirabilis HI4320

Site:
position = -47
score = 4.90015
sequence = ACCTGTATATACTCACAGTC

Site:
position = -26
score = 5.19791
sequence = GACTGTATAAACAAACAGGG

Gene: PMI2749: LexA repressor
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -26
score = 5.19791
sequence = GACTGTATAAACAAACAGGG

Gene: plu4374: LexA repressor
SOS-response repressor and protease LexA (EC 3.4.21.88)
dinF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4044: DNA-damage-inducible SOS response protein
 
Salmonella typhimurium LT2

Gene: STM4238: DNA-damage-inducible SOS response protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03870: DNA-damage-inducible SOS response protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04432: DNA-damage-inducible SOS response protein
 
Enterobacter sp. 638

Gene: Ent638_0248: DNA-damage-inducible SOS response protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0265: DNA-damage-inducible SOS response protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4459: DNA-damage-inducible SOS response protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0231: DNA-damage-inducible SOS response protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-damage-inducible SOS response protein
 
CRON 7.
ftsK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -96
score = 5.03028
sequence = TCCTGTTAATCCATACAGCA

Gene: b0890: DNA translocase FtsK
*
Salmonella typhimurium LT2

Site:
position = -96
score = 5.03028
sequence = TCCTGTTAATCCATACAGCA

Gene: STM0960: DNA translocase FtsK
*
Citrobacter koseri ATCC BAA-895

Site:
position = -39
score = 5.03028
sequence = TCCTGTTAATCCATACAGCA

Gene: CKO_02181: DNA translocase FtsK
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -97
score = 5.03028
sequence = TCCTGTTAATCCATACAGCA

Gene: KPN_00922: DNA translocase FtsK
*
Enterobacter sp. 638

Site:
position = -96
score = 5.03028
sequence = TCCTGTTAATCCATACAGCA

Gene: Ent638_1414: DNA translocase FtsK
*
Erwinia amylovora ATCC 49946

Site:
position = -80
score = 4.90191
sequence = TCCTGTGAATTCATACAGGT

Gene: EAM_1329: DNA translocase FtsK
*
Yersinia pestis KIM

Site:
position = -86
score = 5.66216
sequence = TCCTGTTTATTCATACAGTT

Gene: y2800: DNA translocase FtsK
*
Serratia proteamaculans 568

Site:
position = -85
score = 5.66216
sequence = TCCTGTTTATTCATACAGTT

Gene: Spro_1683: DNA translocase FtsK
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -78
score = 5.03707
sequence = TCCTGTGAATTTATACAGTC

Gene: ECA2647: DNA translocase FtsK
*
Edwardsiella tarda EIB202

Site:
position = -114
score = 5.42392
sequence = TCCTGTGTATGTATACAGTT

Gene: ETAE_2199: DNA translocase FtsK
*
Proteus mirabilis HI4320

Site:
position = -83
score = 5.5741
sequence = TCCTGTTTATGTATACAGTT

Gene: PMI0697: DNA translocase FtsK
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -81
score = 5.45714
sequence = TCCTGTTTATGCATACAGTT

Gene: plu1601: DNA translocase FtsK
DNA translocase FtsK
 
CRON 8.
ydjM
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -52
score = 4.43806
sequence = CACTGTATAAAAATCCTATA

Site:
position = -34
score = 4.6848
sequence = TACTGTACGTATCGACAGTT

Gene: b1728: membrane-bound metal-dependent hydrolase
*
Salmonella typhimurium LT2

Site:
position = -52
score = 4.38267
sequence = TACTGTATAAAAACCCTATA

Site:
position = -34
score = 5.16715
sequence = TACTGTATGAATTGACAGTT

Gene: STM1321: membrane-bound metal-dependent hydrolase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -52
score = 4.38267
sequence = TACTGTATAAAAACCCTATA

Site:
position = -34
score = 5.16715
sequence = TACTGTATGAATTGACAGTT

Gene: CKO_01754: membrane-bound metal-dependent hydrolase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -34
score = 5.01253
sequence = TACTGTATGAATCGACAGTT

Gene: KPN_01239: membrane-bound metal-dependent hydrolase
*
Enterobacter sp. 638

Site:
position = -34
score = 5.16715
sequence = TACTGTATGAATTGACAGTT

Gene: Ent638_1715: membrane-bound metal-dependent hydrolase
*
Erwinia amylovora ATCC 49946

Site:
position = -56
score = 4.31486
sequence = TACTGTATATATTCCCTATA

Site:
position = -38
score = 4.75
sequence = TACTGGATGCATTGACAGTT

Gene: EAM_1619: membrane-bound metal-dependent hydrolase
*
Yersinia pestis KIM

Site:
position = -39
score = 5.04193
sequence = TACTGGATAAATCAACAGCT

Gene: y1879: membrane-bound metal-dependent hydrolase
*
Serratia proteamaculans 568

Site:
position = -39
score = 5.43022
sequence = TACTGGATAAATTAACAGTT

Gene: Spro_2124: membrane-bound metal-dependent hydrolase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -36
score = 5.44466
sequence = TACTGTATAAAATAACAGTT

Gene: ECA2409: membrane-bound metal-dependent hydrolase
*
Edwardsiella tarda EIB202

Site:
position = -109
score = 5.54338
sequence = TTCTGTATATTTATACAGCA

Gene: ETAE_1569: membrane-bound metal-dependent hydrolase
*
Proteus mirabilis HI4320

Site:
position = -54
score = 5.22853
sequence = CACTGTATAAATGAACAGCA

Gene: PMI1020: membrane-bound metal-dependent hydrolase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -37
score = 5.04156
sequence = GACTGTATGGATAGACAGTT

Gene: plu2679: membrane-bound metal-dependent hydrolase
membrane-bound metal-dependent hydrolase
 
CRON 9.
recN
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -68
score = 5.71388
sequence = TACTGTATATAAAACCAGTT

Site:
position = -46
score = 4.93187
sequence = TACTGTACACAATAACAGTA

Site:
position = -28
score = 4.69075
sequence = TAATGGTTTTTCATACAGGA

Gene: b2616: DNA repair protein RecN
*
Salmonella typhimurium LT2

Site:
position = -68
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -46
score = 5.28746
sequence = TACTGTATTTAATTACAGTC

Site:
position = -28
score = 4.4541
sequence = TCATGGTTTTTCATACAGGA

Gene: STM2684: DNA repair protein RecN
*
Citrobacter koseri ATCC BAA-895

Site:
position = -68
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -46
score = 5.067
sequence = TACTGTATGTAATCACAGTC

Site:
position = -28
score = 4.4541
sequence = TCATGGTTTTTCATACAGGA

Gene: CKO_03938: DNA repair protein RecN
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -68
score = 5.17538
sequence = TACTGGATAAAAAACCAGTC

Site:
position = -46
score = 5.24317
sequence = TACTGTACGAAAACACAGTA

Site:
position = -28
score = 4.87211
sequence = TATTGGTTTTTCATACAGGA

Gene: KPN_02938: DNA repair protein RecN
*
Enterobacter sp. 638

Site:
position = -68
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -46
score = 5.81642
sequence = TACTGTATAGAAATACAGTT

Gene: Ent638_3096: DNA repair protein RecN
*
Erwinia amylovora ATCC 49946

Site:
position = -68
score = 5.69075
sequence = TACTGTTTATAAAACCAGTA

Site:
position = -46
score = 4.2819
sequence = TACTGTATGAAAAACCATAT

Site:
position = -28
score = 4.79668
sequence = ATCTGTGTTTTCATACAGGA

Gene: EAM_2529: DNA repair protein RecN
*
Yersinia pestis KIM

Site:
position = 39
score = 5.49543
sequence = TACTGTATATAAAACCAGTC

Site:
position = 61
score = 4.52913
sequence = TACTGTGTTCAAATACAGAC

Gene: y3075: DNA repair protein RecN
*
Serratia proteamaculans 568

Site:
position = -68
score = 5.49543
sequence = TACTGTATATAAAACCAGTC

Site:
position = -46
score = 5.02291
sequence = TACTGTATGAAACCACAGTT

Site:
position = -28
score = 4.45997
sequence = TTATGTATTTATACACAGGA

Gene: Spro_3686: DNA repair protein RecN
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -61
score = 5.71388
sequence = TACTGTATATAAAACCAGTT

Site:
position = -39
score = 5.44042
sequence = TACTGTATGTAAACACAGTC

Gene: ECA0840: DNA repair protein RecN
*
Edwardsiella tarda EIB202

Site:
position = -68
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -46
score = 4.61122
sequence = TACTGGCATTAAACACAGTA

Gene: ETAE_2737: DNA repair protein RecN
*
Proteus mirabilis HI4320

Site:
position = -66
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -44
score = 5.06902
sequence = TACTGTATGTAATTACAGAT

Gene: PMI1902: DNA repair protein RecN
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -68
score = 5.60596
sequence = TACTGTATAAAAAACCAGTT

Site:
position = -46
score = 4.83985
sequence = TACTGTATGAAGATACAGAG

Site:
position = -28
score = 4.50938
sequence = AGGTGTTTTTATACACAGGA

Gene: plu3374: DNA repair protein RecN
DNA repair protein RecN
 
CRON 10.
uvrB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -94
score = 5.60596
sequence = AACTGTTTTTTTATCCAGTA

Gene: b0779: Excinuclease ABC subunit B
*
Salmonella typhimurium LT2

Site:
position = -93
score = 5.61688
sequence = TACTGTTTTTTCATCCAGTA

Gene: STM0798: Excinuclease ABC subunit B
*
Citrobacter koseri ATCC BAA-895

Site:
position = -93
score = 5.37108
sequence = CACTGTTTTTTCATCCAGTA

Gene: CKO_02348: Excinuclease ABC subunit B
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -95
score = 5.68573
sequence = CACTGTTTAAATATCCAGTA

Gene: KPN_00804: Excinuclease ABC subunit B
*
Enterobacter sp. 638

Site:
position = -95
score = 5.41789
sequence = CACTGGATTTACATCCAGTA

Gene: Ent638_1271: Excinuclease ABC subunit B
*
Erwinia amylovora ATCC 49946

Site:
position = -96
score = 4.71081
sequence = AGCTGTGATTATATCCAGTG

Gene: EAM_1216: Excinuclease ABC subunit B
*
Yersinia pestis KIM

Site:
position = -97
score = 5.26808
sequence = AGCTGGTTTTATATCCAGTA

Gene: y3026: Excinuclease ABC subunit B
*
Serratia proteamaculans 568

Site:
position = -130
score = 5.26808
sequence = AGCTGGTTTTATATCCAGTA

Gene: Spro_1317: Excinuclease ABC subunit B
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -232
score = 5.60809
sequence = TgCTGTtTtTATATcCAGTA

Gene: ECA2820: Excinuclease ABC subunit B
*
Edwardsiella tarda EIB202

Site:
position = -106
score = 5.20766
sequence = AGCTGGGTAAATATCCAGTA

Gene: ETAE_2547: Excinuclease ABC subunit B
*
Proteus mirabilis HI4320

Site:
position = -51
score = 5.31117
sequence = AGCTGGATTTTTATCCAGTA

Gene: PMI0607: Excinuclease ABC subunit B
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -56
score = 5.26808
sequence = AGCTGGTTTTATATCCAGTA

Gene: plu1491: Excinuclease ABC subunit B
Excinuclease ABC subunit B
 
CRON 11.
ruvA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -69
score = 5.0046
sequence = CGCTGGATATCTATCCAGCA

Gene: b1861: Holliday junction helicase subunit A
*
Salmonella typhimurium LT2

Site:
position = -71
score = 4.76161
sequence = ATCTGGATAAACATCCAGTC

Gene: STM1895: Holliday junction helicase subunit A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -70
score = 4.55772
sequence = GGCTGGATATCTATCCAGCC

Gene: CKO_01099: Holliday junction helicase subunit A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -69
score = 4.55772
sequence = GGCTGGATATCTATCCAGCC

Gene: KPN_02376: Holliday junction helicase subunit A
*
Enterobacter sp. 638

Site:
position = -69
score = 4.59343
sequence = GGCTGGATAAACATCCAGCC

Gene: Ent638_2430: Holliday junction helicase subunit A
*
Erwinia amylovora ATCC 49946

Site:
position = -68
score = 4.99462
sequence = AGCTGGATATCTATCCAGCT

Gene: EAM_2004: Holliday junction helicase subunit A
*
Yersinia pestis KIM

Site:
position = -244
score = 4.44076
sequence = GGCTGGATATCCATCCAGCC

Gene: y2253: Holliday junction helicase subunit A
*
Serratia proteamaculans 568

Site:
position = -91
score = 4.59343
sequence = GGCTGGATATTCATCCAGCC

Gene: Spro_2777: Holliday junction helicase subunit A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -84
score = 4.93977
sequence = TGCTGGATATTCATCCAGCC

Gene: ECA2492: Holliday junction helicase subunit A
*
Edwardsiella tarda EIB202

Site:
position = -74
score = 4.59343
sequence = GGCTGGATATTCATCCAGCC

Gene: ETAE_1439: Holliday junction helicase subunit A
*
Proteus mirabilis HI4320

Site:
position = -68
score = 4.48415
sequence = GGCTGGATATACGTCCAGCT

Gene: PMI1115: Holliday junction helicase subunit A
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -85
score = 4.60686
sequence = GGCTGGATATGCATCCAGCT

Gene: plu2111: Holliday junction helicase subunit A
Holliday junction helicase subunit A
ruvB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1860: Holliday junction DNA helicase B
 
Salmonella typhimurium LT2

Gene: STM1894: Holliday junction DNA helicase B
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01101: Holliday junction DNA helicase B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02375: Holliday junction DNA helicase B
 
Enterobacter sp. 638

Gene: Ent638_2429: Holliday junction DNA helicase B
 
Erwinia amylovora ATCC 49946

Gene: EAM_2003: Holliday junction DNA helicase B
 
Yersinia pestis KIM

Gene: y2252: Holliday junction DNA helicase B
 
Serratia proteamaculans 568

Gene: Spro_2776: Holliday junction DNA helicase B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2491: Holliday junction DNA helicase B
 
Edwardsiella tarda EIB202

Gene: ETAE_1440: Holliday junction DNA helicase B
 
Proteus mirabilis HI4320

Gene: PMI1116: Holliday junction DNA helicase B
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2112: Holliday junction DNA helicase B
Holliday junction DNA helicase B
 
CRON 12.
yebG
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -37
score = 5.29448
sequence = TACTGTATAAAATCACAGTT

Gene: b1848: SOS regulon DNA damage-inducible protein
*
Salmonella typhimurium LT2

Site:
position = -37
score = 5.53918
sequence = TACTGTATATAAACACAGGT

Gene: STM1882: SOS regulon DNA damage-inducible protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -38
score = 4.79762
sequence = TGCTGTACATAATTACAGGT

Gene: CKO_01118: SOS regulon DNA damage-inducible protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -35
score = 5.85118
sequence = TACTGTATAAAAATACAGTG

Gene: KPN_02363: SOS regulon DNA damage-inducible protein
*
Enterobacter sp. 638

Site:
position = -33
score = 5.33989
sequence = CACTGTATATAATTACAGTG

Gene: Ent638_1887: SOS regulon DNA damage-inducible protein
*
Erwinia amylovora ATCC 49946

Site:
position = -35
score = 5.6679
sequence = TACTGTATAAAAACACAGTT

Gene: EAM_1993: SOS regulon DNA damage-inducible protein
*
Yersinia pestis KIM

Site:
position = -47
score = 5.15661
sequence = CACTGTGATTATATACAGTT

Gene: y2530: SOS regulon DNA damage-inducible protein
*
Serratia proteamaculans 568

Site:
position = -44
score = 6.09698
sequence = TACTGTATAAAAATACAGTA

Gene: Spro_2803: SOS regulon DNA damage-inducible protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -31
score = 5.8081
sequence = TACTGTATATAAAAACAGTG

Gene: ETAE_1833: SOS regulon DNA damage-inducible protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
SOS regulon DNA damage-inducible protein
 
CRON 13.
dinG
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -34
score = 4.94821
sequence = TATTGGCTGTTTATACAGTA

Gene: b0799: ATP-dependent helicase DinG/Rad3
*
Salmonella typhimurium LT2

Site:
position = -34
score = 4.81122
sequence = TAGTGGCTGTTTATACAGTA

Gene: STM0821: ATP-dependent helicase DinG/Rad3
*
Citrobacter koseri ATCC BAA-895

Site:
position = -34
score = 4.81122
sequence = TAGTGGCTGTTTATACAGTA

Gene: CKO_02329: ATP-dependent helicase DinG/Rad3
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -33
score = 4.81122
sequence = TAGTGGCTGTTTATACAGTA

Gene: KPN_00831: ATP-dependent helicase DinG/Rad3
*
Enterobacter sp. 638

Site:
position = -34
score = 4.81122
sequence = TAGTGGCTGTTTATACAGTA

Gene: Ent638_1289: ATP-dependent helicase DinG/Rad3
*
Erwinia amylovora ATCC 49946

Site:
position = -43
score = 4.78012
sequence = TACTGTGCAAAAATACAGCC

Gene: EAM_1250: ATP-dependent helicase DinG/Rad3
 
Yersinia pestis KIM

Gene: y2982: ATP-dependent helicase DinG/Rad3
 
Serratia proteamaculans 568

Gene: Spro_1461: ATP-dependent helicase DinG/Rad3
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2786: ATP-dependent helicase DinG/Rad3
 
Edwardsiella tarda EIB202

Gene: ETAE_1175: ATP-dependent helicase DinG/Rad3
 
Proteus mirabilis HI4320

Gene: PMI0630: ATP-dependent helicase DinG/Rad3
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1524: ATP-dependent helicase DinG/Rad3
ATP-dependent helicase DinG/Rad3
 
CRON 14.
polB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -73
score = 4.3414
sequence = GACTGTATAAAACCACAGCC

Gene: b0060: DNA polymerase II (EC 2.7.7.7)
*
Salmonella typhimurium LT2

Site:
position = -73
score = 4.5539
sequence = gcCTGTAcAaAataACAGTA

Gene: STM0097: DNA polymerase II (EC 2.7.7.7)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -73
score = 4.66954
sequence = ACCTGTATAAAACCACAGCA

Gene: CKO_03322: DNA polymerase II (EC 2.7.7.7)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -75
score = 4.21162
sequence = ACCTGTATAAAACCCCAGCG

Gene: KPN_00059: DNA polymerase II (EC 2.7.7.7)
*
Enterobacter sp. 638

Site:
position = 30
score = 4.61203
sequence = ACCTGTATAAAATCCCAGCA

Gene: Ent638_0607: DNA polymerase II (EC 2.7.7.7)
*
Erwinia amylovora ATCC 49946

Site:
position = -53
score = 4.87119
sequence = TACTGTATAAATAAACATGC

Gene: EAM_0673: DNA polymerase II (EC 2.7.7.7)
 
Yersinia pestis KIM

Gene: y3655: DNA polymerase II (EC 2.7.7.7)
 
Serratia proteamaculans 568

Gene: Spro_0731: DNA polymerase II (EC 2.7.7.7)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3852: DNA polymerase II (EC 2.7.7.7)
 
Edwardsiella tarda EIB202

Gene: ETAE_0607: DNA polymerase II (EC 2.7.7.7)
 
Proteus mirabilis HI4320

Gene: PMI2327: DNA polymerase II (EC 2.7.7.7)
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA polymerase II (EC 2.7.7.7)
 
CRON 15.
cho
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -33
score = 5.08726
sequence = CACTGGATAGATAACCAGCA

Gene: b1741: endonuclease of nucleotide excision repair
*
Salmonella typhimurium LT2

Site:
position = -6
score = 5.47456
sequence = TACTGGATGAATAACCAGTT

Gene: STM1309: endonuclease of nucleotide excision repair
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -32
score = 5.30365
sequence = TACTGGATGGATAGACAGTA

Gene: KPN_01227: endonuclease of nucleotide excision repair
*
Enterobacter sp. 638

Site:
position = -33
score = 5.04893
sequence = CACTGTATAGCTGAACAGTA

Gene: Ent638_1703: endonuclease of nucleotide excision repair
*
Erwinia amylovora ATCC 49946

Site:
position = -33
score = 5.28735
sequence = TACTGTTCGGATAAACAGTA

Gene: EAM_1613: endonuclease of nucleotide excision repair
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
endonuclease of nucleotide excision repair
 
CRON 16.
tag
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3549: DNA-3-methyladenine glycosylase I
 
Salmonella typhimurium LT2

Gene: STM3642: DNA-3-methyladenine glycosylase I
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04999: DNA-3-methyladenine glycosylase I
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03907: DNA-3-methyladenine glycosylase I
 
Enterobacter sp. 638

Gene: Ent638_0175: DNA-3-methyladenine glycosylase I
 
Erwinia amylovora ATCC 49946

Gene: EAM_3433: DNA-3-methyladenine glycosylase I
 
Yersinia pestis KIM

Gene: y4091: DNA-3-methyladenine glycosylase I
*
Serratia proteamaculans 568

Site:
position = -34
score = 5.29662
sequence = TACTGTAAATAAACACAGCA

Gene: Spro_0064: DNA-3-methyladenine glycosylase I
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -115
score = 4.89641
sequence = CGCTGGTTGCATATACAGCA

Gene: ECA0082: DNA-3-methyladenine glycosylase I
 
Edwardsiella tarda EIB202

Gene: ETAE_0014: DNA-3-methyladenine glycosylase I
*
Proteus mirabilis HI4320

Site:
position = -78
score = 4.74178
sequence = ACATGTGTTTTTATACAGTA

Gene: PMI2853: DNA-3-methyladenine glycosylase I
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -65
score = 5.14145
sequence = ACTTGTATATCTATACAGTT

Gene: plu0292: DNA-3-methyladenine glycosylase I
DNA-3-methyladenine glycosylase I
 
CRON 17.
mug
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -69
score = 4.91529
sequence = TGCTGTTTTTATAAACAATG

Gene: b3068: DNA glycosylase, G/U mismatch specific
*
Salmonella typhimurium LT2

Site:
position = -70
score = 4.91529
sequence = TGCTGTTTTTATAAACAATG

Gene: STM3212: DNA glycosylase, G/U mismatch specific
*
Citrobacter koseri ATCC BAA-895

Site:
position = -70
score = 4.68162
sequence = TGCTGTTTTTATAAACAACG

Gene: CKO_04467: DNA glycosylase, G/U mismatch specific
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -69
score = 4.91529
sequence = TGCTGTTTTTATAAACAATG

Gene: KPN_03475: DNA glycosylase, G/U mismatch specific
*
Enterobacter sp. 638

Site:
position = -70
score = 4.91529
sequence = TGCTGTTTTTATAAACAATG

Gene: Ent638_3474: DNA glycosylase, G/U mismatch specific
 
Erwinia amylovora ATCC 49946

Gene: EAM_3006: DNA glycosylase, G/U mismatch specific
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4301: DNA glycosylase, G/U mismatch specific
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0679: DNA glycosylase, G/U mismatch specific
 
Edwardsiella tarda EIB202

Gene: ETAE_0453: DNA glycosylase, G/U mismatch specific
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA glycosylase, G/U mismatch specific
 
CRON 18.
uvrA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -103
score = 5.45345
sequence = TACTGTATATTCATTCAGGT

Gene: b4058: excinuclease ABC subunit A
*
Salmonella typhimurium LT2

Site:
position = -100
score = 5.66216
sequence = TACTGTATATTCAAACAGGT

Gene: STM4254: excinuclease ABC subunit A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -102
score = 5.30078
sequence = TACTGTATATCCATTCAGGT

Gene: CKO_03843: excinuclease ABC subunit A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -105
score = 5.45345
sequence = TACTGTATATTCATTCAGGT

Gene: KPN_04445: excinuclease ABC subunit A
*
Enterobacter sp. 638

Site:
position = -100
score = 5.66216
sequence = TACTGTATATTCAAACAGGT

Gene: Ent638_0261: excinuclease ABC subunit A
*
Erwinia amylovora ATCC 49946

Site:
position = -101
score = 4.47338
sequence = CACTGGTTATCCATTCAGGC

Gene: EAM_0307: excinuclease ABC subunit A
*
Yersinia pestis KIM

Site:
position = -318
score = 4.84285
sequence = CACTGGATATCCATTCAGGT

Gene: y0580: excinuclease ABC subunit A
*
Serratia proteamaculans 568

Site:
position = -140
score = 5.24132
sequence = TACTGGATATTCATTCAGGT

Gene: Spro_4440: excinuclease ABC subunit A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -107
score = 5.47797
sequence = TACTGGATATTCATTCAGTT

Gene: ECA3689: excinuclease ABC subunit A
*
Edwardsiella tarda EIB202

Site:
position = -92
score = 5.3253
sequence = TACTGGATATCCATTCAGTT

Gene: ETAE_3184: excinuclease ABC subunit A
*
Proteus mirabilis HI4320

Site:
position = -84
score = 5.30376
sequence = TACTGTATATCCATTCAGCT

Gene: PMI2746: excinuclease ABC subunit A
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -209
score = 5.28492
sequence = TACTGTATATCTAATCAGTC

Gene: plu4350: excinuclease ABC subunit A
excinuclease ABC subunit A
 
CRON 19.
dinI
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -39
score = 5.56699
sequence = ACCTGTATAAATAACCAGTA

Gene: b1061: DNA damage-inducible protein
*4
Salmonella typhimurium LT2

Site:
position = -39
score = 6.06258
sequence = AACTGTATATATATCCAGTA

Gene: STM1162: DNA damage-inducible protein

Site:
position = -35
score = 6.00674
sequence = TACTGTATATACAAACAGTT

Gene: STM1056: DNA damage-inducible protein

Site:
position = -39
score = 5.65792
sequence = TACTGTGTTTATATACAGTG

Gene: STM2621: DNA damage-inducible protein

Site:
position = -39
score = 5.65792
sequence = TACTGTGTTTATATACAGTG

Gene: STM1019: DNA damage-inducible protein
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -39
score = 5.86559
sequence = AACTGTATAAATACACAGTA

Gene: CKO_02002: DNA damage-inducible protein

Site:
position = -25
score = 6.09698
sequence = TACTGTATAaAaATACAGTA

Gene: CKO_01890: DNA damage-inducible protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -39
score = 5.93153
sequence = TACTGTATAAATAACCAGTA

Gene: KPN_01073: DNA damage-inducible protein
*3
Enterobacter sp. 638

Site:
position = -39
score = 5.79732
sequence = GACTGTATAAATAAACAGTA

Gene: Ent638_1575: DNA damage-inducible protein

Site:
position = -32
score = 5.69234
sequence = TGCTGTATATAAAAACAGTT

Gene: Ent638_1656: DNA damage-inducible protein

Site:
position = -38
score = 5.48533
sequence = CACTGTATAAATGTACAGTT

Gene: Ent638_2256: DNA damage-inducible protein
*
Erwinia amylovora ATCC 49946

Site:
position = -38
score = 5.7734
sequence = AACTGTATATATTTACAGTT

Gene: EAM_1429: DNA damage-inducible protein
*
Yersinia pestis KIM

Site:
position = -41
score = 6.14366
sequence = TACTGTATAAATAAACAGTA

Gene: y1747: DNA damage-inducible protein
*
Serratia proteamaculans 568

Site:
position = -39
score = 5.95466
sequence = AACTGTATAAATATCCAGTA

Gene: Spro_1895: DNA damage-inducible protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -38
score = 5.88789
sequence = AACTGTATAAATAAACAGTT

Gene: ECA1786: DNA damage-inducible protein
*
Edwardsiella tarda EIB202

Site:
position = -42
score = 5.66762
sequence = AGCTGTATATATTTACAGTA

Gene: ETAE_2072: DNA damage-inducible protein
*
Proteus mirabilis HI4320

Site:
position = -45
score = 6.07702
sequence = TACTGTATTTATATACAGTT

Gene: PMI1958: DNA damage-inducible protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -65
score = 5.66491
sequence = TACTGTTTATATGAACAGTA

Gene: plu1815: DNA damage-inducible protein
DNA damage-inducible protein
 
CRON 20.
tisB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -254
score = 6.14366
sequence = TACTGTTTATTTATACAGTA

Gene: b4618: lexA-regulated toxic peptide
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
lexA-regulated toxic peptide
 
CRON 21.
sbmC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -34
score = 6.0539
sequence = TACTGTATATAAAAACAGTA

Gene: b2009: DNA gyrase inhibitor
*
Salmonella typhimurium LT2

Site:
position = -41
score = 5.50838
sequence = TACTGTACATTCATACAGCA

Gene: STM2061: DNA gyrase inhibitor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -157
score = 5.67004
sequence = TGCTGTGTTTATATACAGTA

Gene: CKO_00775: DNA gyrase inhibitor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -42
score = 5.81615
sequence = AGCTGTATATTCATACAGTA

Gene: KPN_02467: DNA gyrase inhibitor
*
Enterobacter sp. 638

Site:
position = -35
score = 5.34837
sequence = TAGTGTATAAATACACAGTA

Gene: Ent638_2577: DNA gyrase inhibitor
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3021: DNA gyrase inhibitor
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1076: DNA gyrase inhibitor
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA gyrase inhibitor
 
CRON 22.
dinD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -63
score = 5.94914
sequence = AACTGTATATAAATACAGTT

Gene: b3645: DNA-damage-inducible protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04089: DNA-damage-inducible protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-damage-inducible protein
 
CRON 23.
dinQ
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -188
score = 4.31841
sequence = TGCTGGTTTTATAACCTGCA

Site:
position = -166
score = 5.72977
sequence = TACTGTATGATTATCCAGTT

Gene: b4613: Damage inducible, function unknown
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Damage inducible, function unknown
 
CRON 24.
impA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -44
score = 5.60955
sequence = TACTGTATGCATAACCAGTA

Gene: KPN_pKPN5p08226: ImpA-like protein; UV protection
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ImpA-like protein; UV protection
KPN_pKPN5p08225
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_pKPN5p08225: mutagenesis by UV and mutagens
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
mutagenesis by UV and mutagens
 
CRON 25.
PMI3143
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -25
score = 5.56147
sequence = AACTGTTTTTATATACAGGT

Gene: PMI3143: DNA modification methyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA modification methyltransferase
PMI3142
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3142: DNA modification methyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA modification methyltransferase
PMI3141
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3141: restriction endonuclease
 
Photorhabdus luminescens subsp. laumondii TTO1
restriction endonuclease
 
CRON 26.
ssb
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -170
score = 5.45345
sequence = ACCTGAATGAATATACAGTA

Gene: b4059: single-strand binding protein
*
Salmonella typhimurium LT2

Site:
position = -167
score = 5.66216
sequence = ACCTGTTTGAATATACAGTA

Gene: STM4256: single-strand binding protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -168
score = 5.30078
sequence = ACCTGAATGGATATACAGTA

Gene: CKO_03842: single-strand binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -166
score = 5.45345
sequence = ACCTGAATGAATATACAGTA

Gene: KPN_04446: single-strand binding protein
*
Enterobacter sp. 638

Site:
position = -165
score = 5.66216
sequence = ACCTGTTTGAATATACAGTA

Gene: Ent638_0262: single-strand binding protein
*
Erwinia amylovora ATCC 49946

Site:
position = -171
score = 4.47338
sequence = GCCTGAATGGATAACCAGTG

Gene: EAM_0308: single-strand binding protein
*
Yersinia pestis KIM

Site:
position = -158
score = 4.84285
sequence = ACCTGAATGGATATCCAGTG

Gene: y0582: single-strand binding protein
*
Serratia proteamaculans 568

Site:
position = -157
score = 5.24132
sequence = ACCTGAATGAATATCCAGTA

Gene: Spro_4439: single-strand binding protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -158
score = 5.47797
sequence = AACTGAATGAATATCCAGTA

Gene: ECA3690: single-strand binding protein
*
Edwardsiella tarda EIB202

Site:
position = -155
score = 5.3253
sequence = AACTGAATGGATATCCAGTA

Gene: ETAE_3183: single-strand binding protein
*
Proteus mirabilis HI4320

Site:
position = -188
score = 5.30376
sequence = AGCTGAATGGATATACAGTA

Gene: PMI2747: single-strand binding protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -169
score = 5.28492
sequence = GACTGATTAGATATACAGTA

Gene: plu4349: single-strand binding protein
single-strand binding protein
 
CRON 27.
yjiW
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -95
score = 4.99929
sequence = TACTGATGATATATACAGGT

Gene: b4347: LexA regulated, putative SOS response
*
Salmonella typhimurium LT2

Site:
position = -94
score = 4.36594
sequence = TACTGATGTTATGTACAGGT

Gene: STM4523: LexA regulated, putative SOS response
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
LexA regulated, putative SOS response
 
CRON 28.
ybfE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -136
score = 4.46557
sequence = AACTGATTAAAAACCCAGCG

Gene: b0685: LexA regulated protein
 
Salmonella typhimurium LT2

Gene: STM0695: LexA regulated protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00708: LexA regulated protein
 
Enterobacter sp. 638

Gene: Ent638_1200: LexA regulated protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1153: LexA regulated protein
 
Yersinia pestis KIM

Gene: y1211: LexA regulated protein
 
Serratia proteamaculans 568

Gene: Spro_1238: LexA regulated protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2608: LexA regulated protein
 
Proteus mirabilis HI4320

Gene: PMI0545: LexA regulated protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1329: LexA regulated protein
LexA regulated protein
 
CRON 29.
samA
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -37
score = 5.23723
sequence = TGCTGTATATAAAAACAGGC

Gene: PSLT055: UV protection protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -35
score = 5.97269
sequence = TACTGTATATGCATACAGTA

Gene: EAM_P216: UV protection protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
UV protection protein
samB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: PSLT054: UV protection protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_P215: UV protection protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
UV protection protein
 
CRON 30.
rmuC
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -64
score = 5.16836
sequence = AACTGGACGTTTATACAGCA

Gene: STM3969: DNA recombination protein RmuC
*
Citrobacter koseri ATCC BAA-895

Site:
position = -60
score = 5.16836
sequence = AACTGGACGTTTATACAGCA

Gene: CKO_00174: DNA recombination protein RmuC
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -60
score = 4.7327
sequence = AACTGGACGTTTGTACAGCA

Gene: KPN_04328: DNA recombination protein RmuC
*
Enterobacter sp. 638

Site:
position = -63
score = 5.16836
sequence = AACTGGACGTTTATACAGCA

Gene: Ent638_3961: DNA recombination protein RmuC
*
Erwinia amylovora ATCC 49946

Site:
position = -64
score = 4.53713
sequence = GTCTGGACATTTATACAGTG

Gene: EAM_0201: DNA recombination protein RmuC
*
Yersinia pestis KIM

Site:
position = -62
score = 4.61383
sequence = CTCTGGACATCCATACAGTA

Gene: y0448: DNA recombination protein RmuC
*
Serratia proteamaculans 568

Site:
position = -86
score = 4.79724
sequence = GACTGGACATCCATACAGCA

Gene: Spro_0247: DNA recombination protein RmuC
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -64
score = 4.85963
sequence = TTCTGGACATCCATACAGTA

Gene: ECA0195: DNA recombination protein RmuC
*
Edwardsiella tarda EIB202

Site:
position = -63
score = 4.48595
sequence = CTCTGGACATCCATACAGTT

Gene: ETAE_0146: DNA recombination protein RmuC
 
Proteus mirabilis HI4320

Gene: PMI3535: DNA recombination protein RmuC
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -65
score = 4.97659
sequence = TTCTGGACATCTATACAGTA

Gene: plu4414: DNA recombination protein RmuC
DNA recombination protein RmuC
 
CRON 31.
yafH
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -73
score = 4.26233
sequence = AAATGTTTTTACATCCACTA

Gene: b0221: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Salmonella typhimurium LT2

Site:
position = -197
score = 3.76006
sequence = TACCGGATAGCAGTACAGGC

Gene: STM0309: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02965: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00235: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Enterobacter sp. 638

Gene: Ent638_0758: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Yersinia pestis KIM

Gene: y0946: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Serratia proteamaculans 568

Gene: Spro_0949: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3474: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0348: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1192: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD