Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 2 2
Salmonella typhimurium LT2 2 2
Citrobacter koseri ATCC BAA-895 2 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 3
Enterobacter sp. 638 3 3
Erwinia amylovora ATCC 49946 2 2
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxS
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -75
score = 7.36766
sequence = ACCTCAAGTTAACTTGAGGA

Gene: b4062: Transcriptional activator of superoxide response regulon, AraC family
*
Salmonella typhimurium LT2

Site:
position = -76
score = 7.36766
sequence = ACCTCAAGTTAACTTGAGGA

Gene: STM4265: Transcriptional activator of superoxide response regulon, AraC family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -76
score = 7.36766
sequence = ACCTCAAGTTAACTTGAGGA

Gene: CKO_03828: Transcriptional activator of superoxide response regulon, AraC family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -74
score = 7.36766
sequence = ACCTCAAGTTAACTTGAGGA

Gene: KPN_04462: Transcriptional activator of superoxide response regulon, AraC family
*
Enterobacter sp. 638

Site:
position = -87
score = 7.36766
sequence = ACCTCAAGTTAACTTGAGGA

Gene: Ent638_0266: Transcriptional activator of superoxide response regulon, AraC family
*
Erwinia amylovora ATCC 49946

Site:
position = -92
score = 7.0704
sequence = ACCTCAAGTAAACTTGAGGA

Gene: EAM_0316: Transcriptional activator of superoxide response regulon, AraC family
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Transcriptional activator of superoxide response regulon, AraC family
 
CRON 2.
soxR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -30
score = 7.36766
sequence = TCCTCAAGTTAACTTGAGGT

Gene: b4063: Redox-sensitive transcriptional activator, MerR family
*
Salmonella typhimurium LT2

Site:
position = -30
score = 7.36766
sequence = TCCTCAAGTTAACTTGAGGT

Gene: STM4266: Redox-sensitive transcriptional activator, MerR family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -30
score = 7.36766
sequence = TCCTCAAGTTAACTTGAGGT

Gene: CKO_03827: Redox-sensitive transcriptional activator, MerR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -57
score = 7.36766
sequence = TCCTCAAGTTAACTTGAGGT

Gene: KPN_04463: Redox-sensitive transcriptional activator, MerR family
*
Enterobacter sp. 638

Site:
position = -31
score = 7.36766
sequence = TCCTCAAGTTAACTTGAGGT

Gene: Ent638_0267: Redox-sensitive transcriptional activator, MerR family
*
Erwinia amylovora ATCC 49946

Site:
position = -30
score = 7.0704
sequence = TCCTCAAGTTTACTTGAGGT

Gene: EAM_0317: Redox-sensitive transcriptional activator, MerR family
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Redox-sensitive transcriptional activator, MerR family
 
CRON 3.
PF00903
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -59
score = 6.87237
sequence = ATCTCAAGTTAACTTGAGGT

Gene: KPN_01861: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Enterobacter sp. 638

Site:
position = -64
score = 6.34835
sequence = ACCTCAAGTTAACTTTAGCT

Gene: Ent638_2697: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glyoxalase/bleomycin resistance protein/dioxygenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD