Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 5 4
Salmonella typhimurium LT2 8 4
Citrobacter koseri ATCC BAA-895 12 5
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 8 4
Enterobacter sp. 638 8 4
Erwinia amylovora ATCC 49946 7 4
Yersinia pestis KIM
Serratia proteamaculans 568 2 2
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -34
score = 6.86993
sequence = AAACATAGCAAAGGCTATGTTT

Gene: b2392: Manganese transporter, NRAMP family
*
Salmonella typhimurium LT2

Site:
position = -34
score = 6.86993
sequence = AAACATAGCAAAGGCTATGTTT

Gene: STM2408: Manganese transporter, NRAMP family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -16
score = 6.86993
sequence = AAACATAGCAAAGGCTATGTTT

Gene: CKO_00404: Manganese transporter, NRAMP family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -35
score = 7.07119
sequence = AAACATAGCAAAGGCTATATTT

Gene: KPN_02743: Manganese transporter, NRAMP family
*
Enterobacter sp. 638

Site:
position = -34
score = 6.78768
sequence = AAACATAGCAAAGGCTATATCT

Gene: Ent638_2926: Manganese transporter, NRAMP family
*
Erwinia amylovora ATCC 49946

Site:
position = -133
score = 6.39868
sequence = AAGTATAGCAATTGCTATATTT

Gene: EAM_2378: Manganese transporter, NRAMP family
 
Yersinia pestis KIM

Gene: y1500: Manganese transporter, NRAMP family
*2
Serratia proteamaculans 568

Site:
position = -70
score = 5.45647
sequence = AAGTGTAGCCGATGCTACATTG

Gene: Spro_1916: Manganese transporter, NRAMP family

Gene: Spro_3415: Manganese transporter, NRAMP family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0843: Manganese transporter, NRAMP family
 
Edwardsiella tarda EIB202

Gene: ETAE_1142: Manganese transporter, NRAMP family
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Manganese transporter, NRAMP family
 
CRON 2.
mntR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -129
score = 6.86638
sequence = AGATATAGCACAGGCTATATTA

Gene: b0817: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Salmonella typhimurium LT2

Site:
position = -128
score = 6.82632
sequence = AGATATAGCACAGGCTATGTTT

Gene: STM0835: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -129
score = 6.86638
sequence = AGATATAGCACAGGCTATATTA

Gene: CKO_02301: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -163
score = 7.02758
sequence = AGATATAGCACAGGCTATATTT

Gene: KPN_00845: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Enterobacter sp. 638

Site:
position = -128
score = 6.90652
sequence = AGATATAGCACAGGCTATATTG

Gene: Ent638_1304: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Erwinia amylovora ATCC 49946

Site:
position = -137
score = 6.62302
sequence = AGATATAGCACAGGCTATATCG

Gene: EAM_1275: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -181
score = 5.30607
sequence = CAATGTAGCATCGGCTACACTT

Gene: Spro_1915: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Manganese homeostasis transcriptional regulator MntR, DtxR family
ybiR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0818: Predicted divalent ion symporter, PF03600
 
Salmonella typhimurium LT2

Gene: STM0836: Predicted divalent ion symporter, PF03600
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02300: Predicted divalent ion symporter, PF03600
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00846: Predicted divalent ion symporter, PF03600
 
Enterobacter sp. 638

Gene: Ent638_1305: Predicted divalent ion symporter, PF03600
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3360: Predicted divalent ion symporter, PF03600
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1541: Predicted divalent ion symporter, PF03600
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Predicted divalent ion symporter, PF03600
 
CRON 3.
sitA
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -57
score = 6.67954
sequence = TAACATAGCAAAGGCTATATTC

Gene: STM2861: Iron and manganese ABC transporter, substrate-binding protein
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -42
score = 6.67954
sequence = TAACATAGCAAAGGCTATATTC

Gene: CKO_04090: Iron and manganese ABC transporter, substrate-binding protein

Site:
position = -88
score = 6.08658
sequence = AAATATAGCCTGTGCTATGTTG

Gene: CKO_00940: Iron and manganese ABC transporter, substrate-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -76
score = 4.65539
sequence = ATAAATAGCTTGTGCTATATAA

Site:
position = -57
score = 5.71966
sequence = TAACATAGCAATGGCTATAAAC

Gene: KPN_03078: Iron and manganese ABC transporter, substrate-binding protein
*
Enterobacter sp. 638

Site:
position = -75
score = 6.2477
sequence = AAATATAGCCTATGCTATATAA

Site:
position = -56
score = 5.31523
sequence = TAAGATAGCACAGGCTAATTTT

Gene: Ent638_1111: Iron and manganese ABC transporter, substrate-binding protein
*
Erwinia amylovora ATCC 49946

Site:
position = -54
score = 4.92093
sequence = TGTTATAGCAATTGCTATTTAG

Site:
position = -73
score = 5.60155
sequence = GGATATAGCCTGTGCTATATGT

Gene: EAM_2087: Iron and manganese ABC transporter, substrate-binding protein
 
Yersinia pestis KIM

Gene: y1897: Iron and manganese ABC transporter, substrate-binding protein
 
Serratia proteamaculans 568

Gene: Spro_2133: Iron and manganese ABC transporter, substrate-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2392: Iron and manganese ABC transporter, substrate-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1027: Iron and manganese ABC transporter, substrate-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2672: Iron and manganese ABC transporter, substrate-binding protein
Iron and manganese ABC transporter, substrate-binding protein
sitB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM2862: Iron and manganese ABC transporter, ATP-binding protein
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04091: Iron and manganese ABC transporter, ATP-binding protein

Gene: CKO_00939: Iron and manganese ABC transporter, ATP-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03079: Iron and manganese ABC transporter, ATP-binding protein
 
Enterobacter sp. 638

Gene: Ent638_1112: Iron and manganese ABC transporter, ATP-binding protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_2088: Iron and manganese ABC transporter, ATP-binding protein
 
Yersinia pestis KIM

Gene: y1896: Iron and manganese ABC transporter, ATP-binding protein
 
Serratia proteamaculans 568

Gene: Spro_2132: Iron and manganese ABC transporter, ATP-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2393: Iron and manganese ABC transporter, ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1026: Iron and manganese ABC transporter, ATP-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2673: Iron and manganese ABC transporter, ATP-binding protein
Iron and manganese ABC transporter, ATP-binding protein
sitC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM2863: Iron and manganese ABC transporter, permease protein 1
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04092: Iron and manganese ABC transporter, permease protein 1

Gene: CKO_00938: Iron and manganese ABC transporter, permease protein 1
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03080: Iron and manganese ABC transporter, permease protein 1
 
Enterobacter sp. 638

Gene: Ent638_1113: Iron and manganese ABC transporter, permease protein 1
 
Erwinia amylovora ATCC 49946

Gene: EAM_2089: Iron and manganese ABC transporter, permease protein 1
 
Yersinia pestis KIM

Gene: y1895: Iron and manganese ABC transporter, permease protein 1
 
Serratia proteamaculans 568

Gene: Spro_2131: Iron and manganese ABC transporter, permease protein 1
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2394: Iron and manganese ABC transporter, permease protein 1
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1025: Iron and manganese ABC transporter, permease protein 1
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2674: Iron and manganese ABC transporter, permease protein 1
Iron and manganese ABC transporter, permease protein 1
sitD
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM2864: Iron and manganese ABC transporter, permease protein 2
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04093: Iron and manganese ABC transporter, permease protein 2

Gene: CKO_00937: Iron and manganese ABC transporter, permease protein 2
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03081: Iron and manganese ABC transporter, permease protein 2
 
Enterobacter sp. 638

Gene: Ent638_1114: Iron and manganese ABC transporter, permease protein 2
 
Erwinia amylovora ATCC 49946

Gene: EAM_2090: Iron and manganese ABC transporter, permease protein 2
 
Yersinia pestis KIM

Gene: y1894: Iron and manganese ABC transporter, permease protein 2
 
Serratia proteamaculans 568

Gene: Spro_2130: Iron and manganese ABC transporter, permease protein 2
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2395: Iron and manganese ABC transporter, permease protein 2
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1024: Iron and manganese ABC transporter, permease protein 2
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2675: Iron and manganese ABC transporter, permease protein 2
Iron and manganese ABC transporter, permease protein 2
 
CRON 4.
dps
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -67
score = 5.26937
sequence = ACACATAGCCGGTGCTATACTT

Gene: b0812: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Salmonella typhimurium LT2

Gene: STM0831: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02310: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00841: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Enterobacter sp. 638

Gene: Ent638_1299: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1272: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Yersinia pestis KIM

Gene: y1677: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Serratia proteamaculans 568

Gene: Spro_1481: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2767: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_1821: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Proteus mirabilis HI4320

Gene: PMI0631: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
Photorhabdus luminescens subsp. laumondii TTO1
Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
 
CRON 5.
mntP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -383
score = 6.19676
sequence = AGACATAGCTTAGGCTATATTA

Site:
position = -423
score = 5.32733
sequence = GAATTTAGCCAAAGCTATGTTT

Gene: b1821: Manganese efflux pump
*
Salmonella typhimurium LT2

Site:
position = -308
score = 6.39727
sequence = TAATATAGCTAAGGCTATATTT

Site:
position = -351
score = 5.12319
sequence = AGATATAGCCTCAACTATGTTT

Gene: STM1834: Manganese efflux pump
*
Citrobacter koseri ATCC BAA-895

Site:
position = -373
score = 6.38309
sequence = AAACATAGCTAAGGCTATATTC

Site:
position = -416
score = 5.20166
sequence = AGATATAGCCTGAACTATGTTT

Gene: CKO_01156: Manganese efflux pump
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -449
score = 5.9927
sequence = AAATATAGCCAGCGCTATATTA

Site:
position = -406
score = 5.81409
sequence = TATTATAGCCACGGCTATATTT

Gene: KPN_02337: Manganese efflux pump
*
Enterobacter sp. 638

Site:
position = -313
score = 5.50111
sequence = ATATATAGCCATCGCTATATTC

Site:
position = -356
score = 6.33319
sequence = AATTATAGCAGAGGCTATATTT

Gene: Ent638_2390: Manganese efflux pump
*
Erwinia amylovora ATCC 49946

Site:
position = -168
score = 5.65227
sequence = AAGTATAGCCGATGCTATAATC

Gene: EAM_3371: Manganese efflux pump
 
Yersinia pestis KIM

Gene: y2555: Manganese efflux pump
 
Serratia proteamaculans 568

Gene: Spro_2817: Manganese efflux pump
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2389: Manganese efflux pump
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1608: Manganese efflux pump
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2701: Manganese efflux pump
Manganese efflux pump
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD