Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MarR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 3 1
Salmonella typhimurium LT2 3 1
Citrobacter koseri ATCC BAA-895 3 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 1
Enterobacter sp. 638 3 1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
marR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -22
score = 6.27991
sequence = ATTACTTGCCAGGGCAACTAAT

Site:
position = -57
score = 6.81749
sequence = TATACTTGCCTGGGCAATATTA

Gene: b1530: DNA-binding transcriptional repressor MarR
*
Salmonella typhimurium LT2

Site:
position = -22
score = 6.79352
sequence = ATTACTTGCCGGGGCAACCATT

Site:
position = -57
score = 6.9657
sequence = TATACTTGCCTGGGCAATAGTA

Gene: STM1520: DNA-binding transcriptional repressor MarR
*
Citrobacter koseri ATCC BAA-895

Site:
position = -22
score = 6.73484
sequence = ACTACTTGCCGGGGCAACCATT

Site:
position = -57
score = 6.66333
sequence = TATATTTGCCTGGGCAATAGTA

Gene: CKO_01551: DNA-binding transcriptional repressor MarR
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -22
score = 6.95983
sequence = ATTACTTGCCTGGGCAACCATT

Site:
position = -57
score = 6.34166
sequence = TATGATTGCCTGGGCAATAGTA

Gene: KPN_01625: DNA-binding transcriptional repressor MarR
*
Enterobacter sp. 638

Site:
position = -58
score = 6.75166
sequence = TATACTTGCCTGAGCAATAATA

Site:
position = -22
score = 6.73484
sequence = ACTACTTGCCAGGGCAACCATT

Gene: Ent638_1998: DNA-binding transcriptional repressor MarR
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding transcriptional repressor MarR
marA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1531: DNA-binding transcriptional activator MarA
 
Salmonella typhimurium LT2

Gene: STM1519.S: DNA-binding transcriptional activator MarA
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01552: DNA-binding transcriptional activator MarA
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01624: DNA-binding transcriptional activator MarA
 
Enterobacter sp. 638

Gene: Ent638_1997: DNA-binding transcriptional activator MarA
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding transcriptional activator MarA
marB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1532: multiple antibiotic resistance protein
 
Salmonella typhimurium LT2

Gene: STM1518: multiple antibiotic resistance protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01553: multiple antibiotic resistance protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01623: multiple antibiotic resistance protein
 
Enterobacter sp. 638

Gene: Ent638_1996: multiple antibiotic resistance protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
multiple antibiotic resistance protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD