Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 9 2
Bacillus amyloliquefaciens FZB42 9 2
Bacillus pumilus SAFR-032 9 2
Bacillus licheniformis DSM 13 9 2
Anoxybacillus flavithermus WK1 9 2
Geobacillus kaustophilus HTA426 2 1
Bacillus cereus ATCC 14579
Bacillus halodurans C-125 9 2
Bacillus clausii KSM-K16 9 2
Oceanobacillus iheyensis HTE831 10 2
Paenibacillus sp. JDR-2 8 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisZ
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -65
score = 5.30038
sequence = CATATTAGCGAACTAAAGGA

Gene: BSU34930: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -61
score = 5.30038
sequence = CATATTAGCGAACTAAAGGA

Gene: RBAM_032140: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Bacillus pumilus SAFR-032

Site:
position = -62
score = 5.30038
sequence = CATATTAGCGAACTAAAGGA

Gene: BPUM_3128: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Bacillus licheniformis DSM 13

Site:
position = -62
score = 5.47964
sequence = CATATTAGCGAACTAAAGTA

Gene: BLi03738: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Anoxybacillus flavithermus WK1

Site:
position = -55
score = 4.87513
sequence = AACTTTACTTTGCTAATATA

Site:
position = -39
score = 5.61978
sequence = TATATTAGCGAACTAAAGTA

Gene: Aflv_2537: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Geobacillus kaustophilus HTA426

Site:
position = -42
score = 5.39188
sequence = CATATTAGCAAACTAAAGCA

Gene: GK3077: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Bacillus cereus ATCC 14579

Gene: BC1404: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Bacillus halodurans C-125

Site:
position = -71
score = 4.34804
sequence = TCCTTTATCTTGTTAGTATA

Site:
position = -55
score = 5.61978
sequence = TATATTAGCGAACTAAAGTA

Gene: BH3584: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Bacillus clausii KSM-K16

Site:
position = -43
score = 5.58061
sequence = TGATTTAGCAAACTAAAGTA

Gene: ABC3050: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Oceanobacillus iheyensis HTE831

Site:
position = -66
score = 4.84255
sequence = AACTTTACTTAGATAAAGTG

Gene: OB0553: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Paenibacillus sp. JDR-2

Site:
position = -37
score = 5.58607
sequence = CACTTTAATATACTAAAGTA

Gene: Pjdr2_0159: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34920: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032130: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3127: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus licheniformis DSM 13

Gene: BLi03737: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2536: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Geobacillus kaustophilus HTA426

Gene: GK3076: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus cereus ATCC 14579

Gene: BC1405: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus halodurans C-125

Gene: BH3583: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Bacillus clausii KSM-K16

Gene: ABC3049: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Oceanobacillus iheyensis HTE831

Gene: OB0552: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0160: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34910: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032120: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3126: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus licheniformis DSM 13

Gene: BLi03736: Histidinol dehydrogenase (EC 1.1.1.23)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2535: Histidinol dehydrogenase (EC 1.1.1.23)
 
Geobacillus kaustophilus HTA426

Gene: GK3075: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus cereus ATCC 14579

Gene: BC1406: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus halodurans C-125

Gene: BH3582: Histidinol dehydrogenase (EC 1.1.1.23)
 
Bacillus clausii KSM-K16

Gene: ABC3048: Histidinol dehydrogenase (EC 1.1.1.23)
 
Oceanobacillus iheyensis HTE831

Gene: OB0551: Histidinol dehydrogenase (EC 1.1.1.23)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0161: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
hisB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34900: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032110: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3125: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus licheniformis DSM 13

Gene: BLi03735: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2534: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Geobacillus kaustophilus HTA426

Gene: GK3074: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus cereus ATCC 14579

Gene: BC1407: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus halodurans C-125

Gene: BH3581: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Bacillus clausii KSM-K16

Gene: ABC3047: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Oceanobacillus iheyensis HTE831

Gene: OB0550: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0162: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34890: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032100: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3124: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus licheniformis DSM 13

Gene: BLi03734: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2533: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3073: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus cereus ATCC 14579

Gene: BC1408: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus halodurans C-125

Gene: BH3580: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Bacillus clausii KSM-K16

Gene: ABC3046: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB0549: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0163: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34880: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032090: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3123: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus licheniformis DSM 13

Gene: BLi03733: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2532: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Geobacillus kaustophilus HTA426

Gene: GK3072: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus cereus ATCC 14579

Gene: BC1409: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus halodurans C-125

Gene: BH3579: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Bacillus clausii KSM-K16

Gene: ABC3045: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Oceanobacillus iheyensis HTE831

Gene: OB0548: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Paenibacillus sp. JDR-2
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34870: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032080: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3122: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi03732: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2531: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3071: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus cereus ATCC 14579

Gene: BC1410: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus halodurans C-125

Gene: BH3578: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Bacillus clausii KSM-K16

Gene: ABC3044: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB0547: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0164: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34860: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_032070: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3121: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus licheniformis DSM 13

Gene: BLi03731: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2530: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Geobacillus kaustophilus HTA426

Gene: GK3070: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus cereus ATCC 14579

Gene: BC1411: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus halodurans C-125

Gene: BH3577: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Bacillus clausii KSM-K16

Gene: ABC3043: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Oceanobacillus iheyensis HTE831

Gene: OB0546: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0165: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
hisC
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB0545: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5865: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisJ
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1413: Histidinol-phosphatase (EC 3.1.3.15)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0166: Histidinol-phosphatase (EC 3.1.3.15)
Histidinol-phosphatase (EC 3.1.3.15)
 
CRON 2.
yuiF
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -39
score = 5.7462
sequence = TACATTAGCAAACTAAAGGA

Gene: BSU32040: Histidine permease
*
Bacillus amyloliquefaciens FZB42

Site:
position = -39
score = 5.7462
sequence = TACATTAGCAAACTAAAGGA

Gene: RBAM_029090: Histidine permease
*
Bacillus pumilus SAFR-032

Site:
position = -36
score = 5.78059
sequence = TACATTAGTAAACTAAAGGA

Gene: BPUM_2865: Histidine permease
*
Bacillus licheniformis DSM 13

Site:
position = -40
score = 5.78531
sequence = TACATTAGCAAACTAAAGTG

Gene: BLi03386: Histidine permease
*
Anoxybacillus flavithermus WK1

Site:
position = -34
score = 5.24991
sequence = CAATTTATCAAACTAAAGTG

Gene: Aflv_1385: Histidine permease
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC4103: Histidine permease
*2
Bacillus halodurans C-125

Site:
position = -47
score = 5.09523
sequence = TGATTTAATAAACTAAAGCA

Gene: BH3359: Histidine permease

Gene: BH1986: Histidine permease
*
Bacillus clausii KSM-K16

Site:
position = -30
score = 4.83117
sequence = TGATTTAATAAGATAAAGGA

Gene: ABC2918: Histidine permease
*
Oceanobacillus iheyensis HTE831

Site:
position = -50
score = 4.79583
sequence = TGCTTTATCATGATGAAGTA

Gene: OB0879: Histidine permease
 
Paenibacillus sp. JDR-2
Histidine permease
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD