Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CymR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 32 8
Bacillus amyloliquefaciens FZB42 31 7
Bacillus pumilus SAFR-032 14 4
Bacillus licheniformis DSM 13 11 6
Anoxybacillus flavithermus WK1 16 6
Geobacillus kaustophilus HTA426 4 3
Bacillus cereus ATCC 14579 16 6
Bacillus halodurans C-125 14 5
Bacillus clausii KSM-K16 11 3
Oceanobacillus iheyensis HTE831 13 4
Paenibacillus sp. JDR-2 29 9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH3125
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -142
score = 4.82737
sequence = TAAAACCCACTTGACAGATGGGGATTA

Site:
position = -50
score = 4.61818
sequence = TAAAACAGACTTTTCCGATCTGTTTTA

Gene: BH3125: Hypothetical protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
BH3126
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3126: Hypothetical protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4820: Hypothetical protein
Hypothetical protein
subI
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*2
Bacillus cereus ATCC 14579

Site:
position = -158
score = 5.41883
sequence = AAATTCCAAGTTGACACATATGAATTA

Gene: BC1090: Sulfate ABC transporter (sulfate-binding protein)

Gene: BC1091: Sulfate ABC transporter (sulfate-binding protein)
 
Bacillus halodurans C-125

Gene: BH3127: Sulfate ABC transporter (sulfate-binding protein)
 
Bacillus clausii KSM-K16

Gene: ABC1226: Sulfate ABC transporter (sulfate-binding protein)
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -96
score = 4.68336
sequence = CATAACCAACTAAACAGGTAGGAATAA

Gene: Pjdr2_4823: Sulfate ABC transporter (sulfate-binding protein)
Sulfate ABC transporter (sulfate-binding protein)
cysT
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1092: Sulfate ABC transporter (permease)
 
Bacillus halodurans C-125

Gene: BH3128: Sulfate ABC transporter (permease)
 
Bacillus clausii KSM-K16

Gene: ABC1227: Sulfate ABC transporter (permease)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4822: Sulfate ABC transporter (permease)
Sulfate ABC transporter (permease)
cysW
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1093: Sulfate ABC transporter (permease)
 
Bacillus halodurans C-125

Gene: BH3129: Sulfate ABC transporter (permease)
 
Bacillus clausii KSM-K16

Gene: ABC1228: Sulfate ABC transporter (permease)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4821: Sulfate ABC transporter (permease)
Sulfate ABC transporter (permease)
cysA
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1094: Sulfate ABC transporter (ATP-binding protein)
 
Bacillus halodurans C-125

Gene: BH3130: Sulfate ABC transporter (ATP-binding protein)
 
Bacillus clausii KSM-K16

Gene: ABC1229: Sulfate ABC transporter (ATP-binding protein)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sulfate ABC transporter (ATP-binding protein)
 
CRON 2.
cysL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU37650: Regulator of sulfur assimilation, activates cysJI expression
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_034830: Regulator of sulfur assimilation, activates cysJI expression
 
Bacillus pumilus SAFR-032

Gene: BPUM_3611: Regulator of sulfur assimilation, activates cysJI expression
*
Bacillus licheniformis DSM 13

Site:
position = -242
score = 5.53218
sequence = CTATTCCTATAAATCAAATCGGTTTTA

Gene: BLi01300: Regulator of sulfur assimilation, activates cysJI expression
*
Anoxybacillus flavithermus WK1

Site:
position = -112
score = 5.36863
sequence = CTATTCCTATAAATCAAGTATGTTTTA

Gene: Aflv_1598: Regulator of sulfur assimilation, activates cysJI expression
 
Geobacillus kaustophilus HTA426

Gene: GK1408: Regulator of sulfur assimilation, activates cysJI expression
 
Bacillus cereus ATCC 14579

Gene: BC5175: Regulator of sulfur assimilation, activates cysJI expression
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB3407: Regulator of sulfur assimilation, activates cysJI expression
 
Paenibacillus sp. JDR-2
Regulator of sulfur assimilation, activates cysJI expression
 
CRON 3.
ytlI
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -125
score = 5.65003
sequence = TAATTCCTATTTGTTTACTAAGCTTTT

Gene: BSU29400: Transcriptional regulator, LysR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -100
score = 5.2597
sequence = TAATTCCAATTTGTTTACTAAGCTTTG

Gene: RBAM_030860: Transcriptional regulator, LysR family
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator, LysR family
 
CRON 4.
cysH
 2
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU10930: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)

Gene: BSU15570: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -299
score = 4.73721
sequence = TTATTCCTATCAAAAAACTCGGGTTGA

Gene: RBAM_015400: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1456: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 2
Bacillus licheniformis DSM 13

Gene: BLi02154: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)

Gene: BLi01778: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
*
Anoxybacillus flavithermus WK1

Site:
position = -100
score = 5.07787
sequence = AAATTCCGATAGAAAAACTAGGATTGA

Gene: Aflv_0316: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 
Geobacillus kaustophilus HTA426

Gene: GK0416: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 
Bacillus cereus ATCC 14579

Gene: BC1421: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 
Bacillus halodurans C-125

Gene: BH1486: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
 
Bacillus clausii KSM-K16

Gene: ABC0611: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
*
Oceanobacillus iheyensis HTE831

Site:
position = -98
score = 5.43421
sequence = CAATTCACATTGTATTACTATGAATTA

Gene: OB1652: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
*
Paenibacillus sp. JDR-2

Site:
position = -45
score = 5.22009
sequence = AATAGCATATGAATTTACTTGGAATTA

Gene: Pjdr2_5647: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
cysJ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33440: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030610: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1777: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
*
Bacillus licheniformis DSM 13

Site:
position = -105
score = 5.53218
sequence = TAAAACCGATTTGATTTATAGGAATAG

Gene: BLi01302: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
*
Anoxybacillus flavithermus WK1

Site:
position = -48
score = 5.36863
sequence = TAAAACATACTTGATTTATAGGAATAG

Gene: Aflv_1597: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Geobacillus kaustophilus HTA426

Gene: GK1409: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -87
score = 5.69493
sequence = TAAAACCAATTTGACTTATCGGAATAA

Gene: BH0609: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Bacillus clausii KSM-K16

Gene: ABC0618: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Oceanobacillus iheyensis HTE831

Gene: OB1653: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1786: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
yvgQ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33430: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030600: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1778: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Bacillus licheniformis DSM 13

Gene: BLi01303: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1596: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Geobacillus kaustophilus HTA426

Gene: GK1410: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0610: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Bacillus clausii KSM-K16

Gene: ABC0619: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Oceanobacillus iheyensis HTE831

Gene: OB1654: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1787: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
ylnD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU15610: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015440: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1460: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Bacillus licheniformis DSM 13

Gene: BLi01782: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0312: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Geobacillus kaustophilus HTA426

Gene: GK0413: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Bacillus cereus ATCC 14579

Gene: BC1426: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1655: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5914: Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
Uroporphyrinogen-III methyltransferase (EC 2.1.1.107)
sirB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU15620: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015450: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1461: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Bacillus licheniformis DSM 13

Gene: BLi01783: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0311: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Geobacillus kaustophilus HTA426

Gene: GK0412: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Bacillus cereus ATCC 14579

Gene: BC1427: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0616: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Oceanobacillus iheyensis HTE831

Gene: OB1656: Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
 
Paenibacillus sp. JDR-2
Sirohydrochlorin ferrochelatase (EC 4.99.1.4)
sirC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU15630: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015460: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1462: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Bacillus licheniformis DSM 13

Gene: BLi01784: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0310: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1428: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0617: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Oceanobacillus iheyensis HTE831

Gene: OB1657: Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
 
Paenibacillus sp. JDR-2
Siroheme synthase / Precorrin-2 oxidase (EC 1.3.1.76)
yjjA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12230: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_012310: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1801: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Bacillus licheniformis DSM 13

Gene: BLi02842: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1473: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Geobacillus kaustophilus HTA426

Gene: GK1829: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2162: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Bacillus clausii KSM-K16

Gene: ABC3411: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Oceanobacillus iheyensis HTE831

Gene: OB1658: Uroporphyrinogen-III synthase (EC 4.2.1.75)
 
Paenibacillus sp. JDR-2
Uroporphyrinogen-III synthase (EC 4.2.1.75)
sat
 2
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU10920: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Gene: BSU15590: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015420: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1458: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Bacillus licheniformis DSM 13

Gene: BLi01780: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Anoxybacillus flavithermus WK1

Site:
position = -48
score = 5.61859
sequence = TTAATCCTAGTTGTTTTATAAGAATAA

Gene: Aflv_0314: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Geobacillus kaustophilus HTA426

Gene: GK0415: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Bacillus cereus ATCC 14579

Gene: BC1422: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 2
Bacillus halodurans C-125

Gene: BH1487: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Gene: BH3386: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Bacillus clausii KSM-K16

Site:
position = -265
score = 4.85026
sequence = AAATACCGAGTTTGTTAATCAGGATAA

Gene: ABC0612: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Oceanobacillus iheyensis HTE831

Gene: OB1659: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Paenibacillus sp. JDR-2
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
BH3384
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3384: Sodium/sulfate symporter
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1660: Sodium/sulfate symporter
 
Paenibacillus sp. JDR-2
Sodium/sulfate symporter
cysC
 2
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU10910: Adenylylsulfate kinase (EC 2.7.1.25)

Gene: BSU15600: Adenylylsulfate kinase (EC 2.7.1.25)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015430: Adenylylsulfate kinase (EC 2.7.1.25)
 
Bacillus pumilus SAFR-032

Gene: BPUM_1459: Adenylylsulfate kinase (EC 2.7.1.25)
 
Bacillus licheniformis DSM 13

Gene: BLi01781: Adenylylsulfate kinase (EC 2.7.1.25)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0313: Adenylylsulfate kinase (EC 2.7.1.25)
 
Geobacillus kaustophilus HTA426

Gene: GK0414: Adenylylsulfate kinase (EC 2.7.1.25)
 
Bacillus cereus ATCC 14579

Gene: BC1423: Adenylylsulfate kinase (EC 2.7.1.25)
*
Bacillus halodurans C-125

Site:
position = -53
score = 5.27852
sequence = TAAAACATAGTAAACAGATATGAATTT

Gene: BH1489: Adenylylsulfate kinase (EC 2.7.1.25)
 
Bacillus clausii KSM-K16

Gene: ABC0614: Adenylylsulfate kinase (EC 2.7.1.25)
 
Oceanobacillus iheyensis HTE831

Gene: OB1661: Adenylylsulfate kinase (EC 2.7.1.25)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4461: Adenylylsulfate kinase (EC 2.7.1.25)
Adenylylsulfate kinase (EC 2.7.1.25)
cysP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU15580: Sulfate permease, Pit-type
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_015410: Sulfate permease, Pit-type
 
Bacillus pumilus SAFR-032

Gene: BPUM_1457: Sulfate permease, Pit-type
 2
Bacillus licheniformis DSM 13

Gene: BLi02153: Sulfate permease, Pit-type

Gene: BLi01779: Sulfate permease, Pit-type
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0315: Sulfate permease, Pit-type
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1488: Sulfate permease, Pit-type
 
Bacillus clausii KSM-K16

Gene: ABC0613: Sulfate permease, Pit-type
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sulfate permease, Pit-type
ABC0615
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0615: uroporphyrin-III C-methyltransferase
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
uroporphyrin-III C-methyltransferase
BH1485
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -73
score = 5.27152
sequence = TAAATCATATCAAATTACATGGAATTA

Gene: BH1485: Hypothetical protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
 
CRON 5.
yhcL
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -73
score = 5.21241
sequence = TAATTCGCACTTGACCCATCGGAATTA

Gene: BSU09130: Sodium-cystine symporter
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_009400: Sodium-cystine symporter
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -77
score = 5.11208
sequence = TAATTCCTACTTGACCAATCAGGTTTG

Gene: BLi00975: Sodium-cystine symporter
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -72
score = 5.47487
sequence = AATTTCATAGTTGACTTATAGGTTTTA

Site:
position = -39
score = 4.7783
sequence = TATATTCTATATAACAGATTGGAATTA

Gene: BC4242: Sodium-cystine symporter
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -78
score = 5.24382
sequence = TAATTCCCACTTGACTCATATGATTAT

Gene: ABC2897: Sodium-cystine symporter
*
Oceanobacillus iheyensis HTE831

Site:
position = -56
score = 6.21503
sequence = TAATTCGTAGTAAATTAATTGGAATTA

Gene: OB2714: Sodium-cystine symporter
*
Paenibacillus sp. JDR-2

Site:
position = -148
score = 5.11822
sequence = AATTCCCCATAGAAATAGTCGGATTTA

Site:
position = -41
score = 4.96353
sequence = TAATTCCAATCAAACAACTTGGATTAG

Gene: Pjdr2_6037: Sodium-cystine symporter
Sodium-cystine symporter
 
CRON 6.
ydbM
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -45
score = 6.36733
sequence = TAATACATATTAAATTTATCGGAATTA

Gene: BSU04520: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -82
score = 6.00118
sequence = TAATACTTATTAACTTTATCGGAATTA

Gene: RBAM_004850: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Bacillus pumilus SAFR-032

Site:
position = -89
score = 5.50323
sequence = TAAATCCTATAAGTAAAGTGTGTTTTA

Site:
position = -61
score = 4.86834
sequence = TTATTCCGATTGGAAAAATCAGATATG

Gene: BPUM_2341: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Bacillus licheniformis DSM 13

Site:
position = -45
score = 5.86902
sequence = TAATACTTATTAAATCTATCGGAATTT

Gene: BLi00540: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1741: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2178: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Bacillus clausii KSM-K16

Gene: ABC2099: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Oceanobacillus iheyensis HTE831

Site:
position = -45
score = 5.49706
sequence = TTATACCTATTGACTTACTAGGCATTA

Gene: OB0293: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1875: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 7.
ytmI
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -54
score = 5.65003
sequence = AAAAGCTTAGTAAACAAATAGGAATTA

Gene: BSU29390: Putative N-acetyltransferase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -54
score = 5.2597
sequence = CAAAGCTTAGTAAACAAATTGGAATTA

Gene: RBAM_030850: Putative N-acetyltransferase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -55
score = 6.12095
sequence = TAATTCTTAGTAAGTTTATAGGAATTA

Gene: Pjdr2_5233: Putative N-acetyltransferase
Putative N-acetyltransferase
ytmJ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29380: Sulfur containing amino acid ABC transporter binding lipoprotein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030840: Sulfur containing amino acid ABC transporter binding lipoprotein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sulfur containing amino acid ABC transporter binding lipoprotein
ytmK
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29370: Sulfur-containing amino acid ABC transporter binding lipoprotein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030830: Sulfur-containing amino acid ABC transporter binding lipoprotein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sulfur-containing amino acid ABC transporter binding lipoprotein
ytmL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29360: Sulfur-containing amino acid ABC transporter (permease)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030820: Sulfur-containing amino acid ABC transporter (permease)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5231: Sulfur-containing amino acid ABC transporter (permease)
Sulfur-containing amino acid ABC transporter (permease)
ytmM
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29350: Sulfur-containing amino acid ABC transporter (permease)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030810: Sulfur-containing amino acid ABC transporter (permease)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5230: Sulfur-containing amino acid ABC transporter (permease)
Sulfur-containing amino acid ABC transporter (permease)
ytmN
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29340: Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030800: Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5229: Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
ytmO
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29330: putative monooxygenase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030790: putative monooxygenase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
putative monooxygenase
ytnI
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29320: glutaredoxin
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030780: glutaredoxin
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
glutaredoxin
ytnJ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29310: Putative monooxygenase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_030770: Putative monooxygenase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative monooxygenase
rbfK
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29300: RNA-binding riboflavin kinase
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
RNA-binding riboflavin kinase
ytnL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29290: Putative aminohydrolase
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5227: Putative aminohydrolase
Putative aminohydrolase
ytnM
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU29280: Hypothetical protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02823: Hypothetical protein
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = -80
score = 5.24574
sequence = AAATTCATAGTTGACATCTATGAATAA

Gene: GK1638: Hypothetical protein
*
Bacillus cereus ATCC 14579

Site:
position = -136
score = 5.39691
sequence = TAAAACCTAGTTGATTTATACGATTAA

Gene: BC3050: Hypothetical protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
Pjdr2_5232
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5232: Extracellular solute-binding protein family 3
Extracellular solute-binding protein family 3
Pjdr2_5228
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5228: Luciferase-like monooxygenase
Luciferase-like monooxygenase
Pjdr2_5226
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5226: Hypothetical protein
Hypothetical protein
Pjdr2_5225
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5225: Nitrilotriacetate monooxygenase protein component A
Nitrilotriacetate monooxygenase protein component A
ABC0022
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5224: N-acyl-L-amino acid amidohydrolase
N-acyl-L-amino acid amidohydrolase
 
CRON 8.
cysK
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -39
score = 5.35628
sequence = TAATACCAATACAAATAGTCGGAAATT

Gene: BSU00730: Cysteine synthase (EC 2.5.1.47)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -39
score = 5.79217
sequence = TAATACCAATAAATTTAGTCGGAAATT

Gene: RBAM_000840: Cysteine synthase (EC 2.5.1.47)
*
Bacillus pumilus SAFR-032

Site:
position = -40
score = 4.62709
sequence = TtAaTaCaATaAAATTAcTcGGAgaTA

Gene: BPUM_0057: Cysteine synthase (EC 2.5.1.47)
*
Bacillus licheniformis DSM 13

Site:
position = -38
score = 5.6362
sequence = TAATCCCAATAAAATTACTCGGAAATT

Gene: BLi00089: Cysteine synthase (EC 2.5.1.47)
*
Anoxybacillus flavithermus WK1

Site:
position = -30
score = 5.04656
sequence = CAAATTCTATAAAAATACTCGGGATTA

Gene: Aflv_0065: Cysteine synthase (EC 2.5.1.47)
*
Geobacillus kaustophilus HTA426

Site:
position = -38
score = 4.71829
sequence = CAAAGTCGATAAAATTAATGGGGATTA

Gene: GK0065: Cysteine synthase (EC 2.5.1.47)
*
Bacillus cereus ATCC 14579

Site:
position = -39
score = 5.27667
sequence = TAAAACCAATAAAAATACTCGGTGTTA

Gene: BC0075: Cysteine synthase (EC 2.5.1.47)
*
Bacillus halodurans C-125

Site:
position = -39
score = 5.1753
sequence = GAAAACCAATAAATTTACTTGGGATTA

Gene: BH0088: Cysteine synthase (EC 2.5.1.47)
*
Bacillus clausii KSM-K16

Site:
position = -42
score = 4.91674
sequence = TAAAACCAATGAAGATACTAGGGATTG

Gene: ABC0109: Cysteine synthase (EC 2.5.1.47)
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 6.0218
sequence = TAAATCTTATAAAAATACTTGGAATTA

Gene: OB0084: Cysteine synthase (EC 2.5.1.47)
*
Paenibacillus sp. JDR-2

Site:
position = -44
score = 5.67061
sequence = AAAAACCAACTAAATTAGTCGGAATAA

Gene: Pjdr2_0074: Cysteine synthase (EC 2.5.1.47)
Cysteine synthase (EC 2.5.1.47)
 
CRON 9.
yrrT
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -49
score = 6.07655
sequence = TAATCCATAGTATACTTATAGGAATTA

Gene: BSU27280: SAM-dependent methyltransferase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -49
score = 5.93116
sequence = TAATCCATACTATACTCATAGGAATTA

Gene: RBAM_024380: SAM-dependent methyltransferase
*
Bacillus pumilus SAFR-032

Site:
position = -51
score = 5.35907
sequence = TAAAACATACTATACGCATAGGAATAA

Gene: BPUM_2363: SAM-dependent methyltransferase
*
Bacillus licheniformis DSM 13

Site:
position = -54
score = 5.84545
sequence = TAAATCATACTATACTTATAGGAATTG

Gene: BLi02856: SAM-dependent methyltransferase
*
Anoxybacillus flavithermus WK1

Site:
position = -36
score = 6.37924
sequence = TAATTCATACTATACTTATAGGAATTA

Gene: Aflv_0758: SAM-dependent methyltransferase
*
Geobacillus kaustophilus HTA426

Site:
position = -51
score = 5.94273
sequence = AAAAACATACTATATTTATAGGAATTA

Gene: GK2543: SAM-dependent methyltransferase
*
Bacillus cereus ATCC 14579

Site:
position = -29
score = 5.11772
sequence = TAAAACCGATAAGAAAAAGGGGAATTT

Gene: BC4369: SAM-dependent methyltransferase
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1106: SAM-dependent methyltransferase
*
Paenibacillus sp. JDR-2

Site:
position = -105
score = 5.16937
sequence = TAAATCCGATTAATAAGGTTGGAAAAA

Gene: Pjdr2_5106: SAM-dependent methyltransferase
SAM-dependent methyltransferase
mtn
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27270: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024370: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2362: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus licheniformis DSM 13

Gene: BLi02855: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0759: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Geobacillus kaustophilus HTA426

Gene: GK2542: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus cereus ATCC 14579

Gene: BC4368: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus halodurans C-125

Gene: BH1279: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Bacillus clausii KSM-K16

Gene: ABC1603: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Oceanobacillus iheyensis HTE831

Gene: OB2000: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
 
Paenibacillus sp. JDR-2
5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
mccA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27260: Cystathionine beta-synthase (EC 4.2.1.22)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024360: Cystathionine beta-synthase (EC 4.2.1.22)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2361: Cystathionine beta-synthase (EC 4.2.1.22)
 
Bacillus licheniformis DSM 13

Gene: BLi02854: Cystathionine beta-synthase (EC 4.2.1.22)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0760: Cystathionine beta-synthase (EC 4.2.1.22)
 
Geobacillus kaustophilus HTA426

Gene: GK2541: Cystathionine beta-synthase (EC 4.2.1.22)
 
Bacillus cereus ATCC 14579

Gene: BC4367: Cystathionine beta-synthase (EC 4.2.1.22)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1944: Cystathionine beta-synthase (EC 4.2.1.22)
 
Oceanobacillus iheyensis HTE831

Gene: OB1108: Cystathionine beta-synthase (EC 4.2.1.22)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5105: Cystathionine beta-synthase (EC 4.2.1.22)
Cystathionine beta-synthase (EC 4.2.1.22)
mccB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27250: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024350: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2360: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Bacillus licheniformis DSM 13

Gene: BLi02853: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0761: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Geobacillus kaustophilus HTA426

Gene: GK2540: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Bacillus cereus ATCC 14579

Gene: BC4366: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1945: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB1109: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5104: Cystathionine gamma-lyase (EC 4.4.1.1)
Cystathionine gamma-lyase (EC 4.4.1.1)
yrhC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27240: Hypothetical protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024340: Hypothetical protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_2359: Hypothetical protein
 
Bacillus licheniformis DSM 13

Gene: BLi02852: Hypothetical protein
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0762: Hypothetical protein
 
Geobacillus kaustophilus HTA426

Gene: GK2539: Hypothetical protein
 
Bacillus cereus ATCC 14579

Gene: BC4364: Hypothetical protein
 
Bacillus halodurans C-125

Gene: BH1280: Hypothetical protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
 
CRON 10.
yxeK
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -82
score = 5.58547
sequence = TTATTCATATTAAACGACTAGGAATAT

Gene: BSU39520: Putative monooxygenase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -85
score = 5.98937
sequence = TTATTCTTATAAAATTACTAGGAAATA

Gene: RBAM_003900: Putative monooxygenase
*
Bacillus pumilus SAFR-032

Site:
position = -84
score = 5.46652
sequence = TAAAACCGATTAATTCAATCAGAAAAA

Gene: BPUM_0345: Putative monooxygenase
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_6183: Putative monooxygenase
Putative monooxygenase
yxeL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39510: Putative acetyltransferase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003910: Putative acetyltransferase
 
Bacillus pumilus SAFR-032

Gene: BPUM_0346: Putative acetyltransferase
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative acetyltransferase
yxeM
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39500: Amino acid ABC superfamily ATP binding cassette transporter, binding protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003920: Amino acid ABC superfamily ATP binding cassette transporter, binding protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_0347: Amino acid ABC superfamily ATP binding cassette transporter, binding protein
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Amino acid ABC superfamily ATP binding cassette transporter, binding protein
yxeN
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39490: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003930: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_0348: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Amino acid ABC superfamily ATP binding cassette transporter, membrane protein
yxeO
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39480: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003940: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_0349: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Amino acid ABC superfamily ATP binding cassette transporter, ABC protein
yxeP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39470: Uncharacterized hydrolase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003950: Uncharacterized hydrolase
 
Bacillus pumilus SAFR-032

Gene: BPUM_0350: Uncharacterized hydrolase
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC3664: Uncharacterized hydrolase
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Uncharacterized hydrolase
yxeQ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39460: Hypothetical protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003960: Hypothetical protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_0351: Hypothetical protein
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hypothetical protein
ssuB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -167
score = 4.64659
sequence = TAAAAAAGAGTTGACATATCGGAATAA

Gene: BSU08830: Aliphatic sulfonate ABC transporter (ATP-binding protein)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_009110: Aliphatic sulfonate ABC transporter (ATP-binding protein)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00941: Aliphatic sulfonate ABC transporter (ATP-binding protein)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -174
score = 5.71562
sequence = TAAAACCTAGTTGACTTATCGGAAATA

Gene: BC2912: Aliphatic sulfonate ABC transporter (ATP-binding protein)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*2
Paenibacillus sp. JDR-2

Site:
position = -53
score = 4.90494
sequence = TAATTCCAAGTAAATCGGTGTGAAAAA

Gene: Pjdr2_6187: Aliphatic sulfonate ABC transporter (ATP-binding protein)

Site:
position = -70
score = 5.28036
sequence = TAATTCCAACTATTCCAATAAGGAAAA

Gene: Pjdr2_0756: Aliphatic sulfonate ABC transporter (ATP-binding protein)
Aliphatic sulfonate ABC transporter (ATP-binding protein)
ssuA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08840: Aliphatic sulfonate ABC transporter (binding lipoprotein)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_009120: Aliphatic sulfonate ABC transporter (binding lipoprotein)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00942: Aliphatic sulfonate ABC transporter (binding lipoprotein)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2911: Aliphatic sulfonate ABC transporter (binding lipoprotein)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*2
Paenibacillus sp. JDR-2

Gene: Pjdr2_6186: Aliphatic sulfonate ABC transporter (binding lipoprotein)

Site:
position = -50
score = 5.2029
sequence = TAAATCCGATTAAACAAATAAGTAAAG

Gene: Pjdr2_0760: Aliphatic sulfonate ABC transporter (binding lipoprotein)
Aliphatic sulfonate ABC transporter (binding lipoprotein)
ssuC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08850: aliphatic sulfonate ABC transporter (permease)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_009130: aliphatic sulfonate ABC transporter (permease)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00943: aliphatic sulfonate ABC transporter (permease)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 2
Paenibacillus sp. JDR-2

Gene: Pjdr2_6185: aliphatic sulfonate ABC transporter (permease)

Gene: Pjdr2_6184: aliphatic sulfonate ABC transporter (permease)
aliphatic sulfonate ABC transporter (permease)
ssuD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08860: Alkanesulfonate monooxygenase (EC 1.14.14.5)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_009140: Alkanesulfonate monooxygenase (EC 1.14.14.5)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00944: Alkanesulfonate monooxygenase (EC 1.14.14.5)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alkanesulfonate monooxygenase (EC 1.14.14.5)
BC2910
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2910: Alkanesulfonates transport system permease protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alkanesulfonates transport system permease protein
BC2909
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2909: Alkanesulfonate monooxygenase
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alkanesulfonate monooxygenase
Pjdr2_0761
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0761: Taurine dioxygenase
Taurine dioxygenase
Pjdr2_0762
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0762: Stress responsive alpha-beta barrel domain protein
Stress responsive alpha-beta barrel domain protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD