Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NikR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: NikR
Regulation mode: repressor
Biological process: Nickel homeostasis
Effector: Nickel ion, (Ni2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 6 1
Salmonella typhimurium LT2 6 2
Citrobacter koseri ATCC BAA-895 6 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 6 1
Enterobacter sp. 638 6 1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202 11 3
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nikA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -65
score = 7.99675
sequence = GTATGACGAATACTTAAAATCGTCATAC

Gene: b3476: nickel ABC transporter, periplasmic nickel-binding protein
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -207
score = 8.04442
sequence = GTATGATGAATCTTTAGAATCGTCATAC

Gene: CKO_04926: nickel ABC transporter, periplasmic nickel-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -52
score = 7.99675
sequence = GTATGATGAATCACTAAAATCGTCATAC

Gene: KPN_03850: nickel ABC transporter, periplasmic nickel-binding protein
*
Enterobacter sp. 638

Site:
position = -64
score = 7.87692
sequence = GTATGATGAATTATTAGAATCGTCACAC

Gene: Ent638_1834: nickel ABC transporter, periplasmic nickel-binding protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -59
score = 7.67008
sequence = GTATGCAGAATTTATAAAATCATCATAC

Gene: ETAE_1379: nickel ABC transporter, periplasmic nickel-binding protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel ABC transporter, periplasmic nickel-binding protein
nikB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3477: nickel transporter permease NikB
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04927: nickel transporter permease NikB
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03851: nickel transporter permease NikB
 
Enterobacter sp. 638

Gene: Ent638_1835: nickel transporter permease NikB
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1378: nickel transporter permease NikB
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel transporter permease NikB
nikC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3478: nickel transporter permease NikC
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04928: nickel transporter permease NikC
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03852: nickel transporter permease NikC
 
Enterobacter sp. 638

Gene: Ent638_1836: nickel transporter permease NikC
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1377: nickel transporter permease NikC
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel transporter permease NikC
nikD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3479: nickel transporter ATP-binding protein NikD
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04929: nickel transporter ATP-binding protein NikD
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03853: nickel transporter ATP-binding protein NikD
 
Enterobacter sp. 638

Gene: Ent638_1837: nickel transporter ATP-binding protein NikD
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1376: nickel transporter ATP-binding protein NikD
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel transporter ATP-binding protein NikD
nikE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3480: nickel transporter ATP-binding protein NikE
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04930: nickel transporter ATP-binding protein NikE
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03854: nickel transporter ATP-binding protein NikE
 
Enterobacter sp. 638

Gene: Ent638_1838: nickel transporter ATP-binding protein NikE
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1375: nickel transporter ATP-binding protein NikE
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel transporter ATP-binding protein NikE
nikR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3481: nickel responsive regulator
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04931: nickel responsive regulator
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03855: nickel responsive regulator
 
Enterobacter sp. 638

Gene: Ent638_1839: nickel responsive regulator
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0262: nickel responsive regulator
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nickel responsive regulator
 
CRON 2.
yntA
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -101
score = 6.50784
sequence = GTATGATGTTTTTAAAAGATCGTCATAC

Gene: STM1255: predicted nickel ABC transporter, substrate-binding protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -171
score = 5.27379
sequence = GTATGCAGAAGTAAGGAAAAGTGCATAC

Gene: ETAE_1580: predicted nickel ABC transporter, substrate-binding protein
 
Proteus mirabilis HI4320

Gene: PMI2516: predicted nickel ABC transporter, substrate-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted nickel ABC transporter, substrate-binding protein
yntB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM1256: predicted nickel ABC transporter, permease protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1579: predicted nickel ABC transporter, permease protein
 
Proteus mirabilis HI4320

Gene: PMI2515: predicted nickel ABC transporter, permease protein
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted nickel ABC transporter, permease protein
yntC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM1257: predicted nickel ABC transporter, permease protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1578: predicted nickel ABC transporter, permease protein
 
Proteus mirabilis HI4320

Gene: PMI2514: predicted nickel ABC transporter, permease protein
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted nickel ABC transporter, permease protein
yntD
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM1258: predicted nickel ABC transporter, ATP-binding protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1577: predicted nickel ABC transporter, ATP-binding protein
 
Proteus mirabilis HI4320

Gene: PMI2513: predicted nickel ABC transporter, ATP-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted nickel ABC transporter, ATP-binding protein
yntE
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM1259: predicted nickel ABC transporter, ATPase component
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_1576: predicted nickel ABC transporter, ATPase component
 
Proteus mirabilis HI4320

Gene: PMI2512: predicted nickel ABC transporter, ATPase component
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted nickel ABC transporter, ATPase component
 
CRON 3.
nxiA
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -79
score = 6.15122
sequence = GTGTGACGTTTTAATCAAATGATCATAC

Gene: STM2783: high-affinity nickel-transporter
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03047: high-affinity nickel-transporter
 
Enterobacter sp. 638

Gene: Ent638_3184: high-affinity nickel-transporter
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1245: high-affinity nickel-transporter
 
Serratia proteamaculans 568

Gene: Spro_2422: high-affinity nickel-transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1252: high-affinity nickel-transporter
*
Edwardsiella tarda EIB202

Site:
position = -120
score = 6.85813
sequence = GTATGACAATTTCATGAAAAGATCATAC

Gene: ETAE_2654: high-affinity nickel-transporter
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2170: high-affinity nickel-transporter
high-affinity nickel-transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD