Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AcrR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector: Rhodamine 6G; Ethidium bromide; Proflavin
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 3 2
Salmonella typhimurium LT2 3 2
Citrobacter koseri ATCC BAA-895 3 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 2
Enterobacter sp. 638 3 2
Erwinia amylovora ATCC 49946 3 2
Yersinia pestis KIM 3 2
Serratia proteamaculans 568 3 2
Erwinia carotovora subsp. atroseptica SCRI1043 3 2
Edwardsiella tarda EIB202 3 2
Proteus mirabilis HI4320 3 2
Photorhabdus luminescens subsp. laumondii TTO1 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acrR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -52
score = 7.34916
sequence = TACATACATTCACAAATGTATGTA

Gene: b0464: acrAB operon repressor
*
Salmonella typhimurium LT2

Site:
position = -52
score = 6.93669
sequence = TACATACATCCATAAATGTATGTA

Gene: STM0477: acrAB operon repressor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -52
score = 6.85813
sequence = TACATACATCCACAAATGTATGTA

Gene: CKO_02687: acrAB operon repressor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -52
score = 7.34916
sequence = TACATACATTCACAAATGTATGTA

Gene: KPN_00445: acrAB operon repressor
*
Enterobacter sp. 638

Site:
position = -52
score = 7.42772
sequence = TACATACATTCATAAATGTATGTA

Gene: Ent638_0944: acrAB operon repressor
*
Erwinia amylovora ATCC 49946

Site:
position = -52
score = 7.30144
sequence = TACATACATTCGCAAATGTATGTA

Gene: EAM_1018: acrAB operon repressor
*
Yersinia pestis KIM

Site:
position = -52
score = 7.87103
sequence = TACATACATTCGTGAATGTATGTA

Gene: y1051: acrAB operon repressor
*
Serratia proteamaculans 568

Site:
position = -52
score = 7.30144
sequence = TACATACATACGCGAATGTATGTA

Gene: Spro_1128: acrAB operon repressor
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -75
score = 7.01536
sequence = TACATACATACTTGAATGTATGTA

Gene: ECA1171: acrAB operon repressor
*
Edwardsiella tarda EIB202

Site:
position = -52
score = 6.93669
sequence = TACATACATTCATCAATGCATGTA

Gene: ETAE_1012: acrAB operon repressor
*
Proteus mirabilis HI4320

Site:
position = -52
score = 6.93669
sequence = TACAAACATACATGAATGTATGTA

Gene: PMI0133: acrAB operon repressor
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -52
score = 6.88898
sequence = TACAAACATACGTGAATGTATGTA

Gene: plu3850: acrAB operon repressor
acrAB operon repressor
 
CRON 2.
acrA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -113
score = 7.89673
sequence = TACATACATTTGTGAATGTATGTA

Gene: b0463: acriflavine resistance protein A
*
Salmonella typhimurium LT2

Site:
position = -113
score = 7.79773
sequence = TACATACATTTATGGATGTATGTA

Gene: STM0476: acriflavine resistance protein A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -113
score = 7.75002
sequence = TACATACATTTGTGGATGTATGTA

Gene: CKO_02688: acriflavine resistance protein A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -114
score = 7.89673
sequence = TACATACATTTGTGAATGTATGTA

Gene: KPN_00444: acriflavine resistance protein A
*
Enterobacter sp. 638

Site:
position = -114
score = 7.94444
sequence = TACATACATTTATGAATGTATGTA

Gene: Ent638_0943: acriflavine resistance protein A
*
Erwinia amylovora ATCC 49946

Site:
position = -105
score = 7.81817
sequence = TACATACATTTGCGAATGTATGTA

Gene: EAM_1017: acriflavine resistance protein A
*
Yersinia pestis KIM

Site:
position = -116
score = 7.84019
sequence = TACATACATTCACGAATGTATGTA

Gene: y1050: acriflavine resistance protein A
*
Serratia proteamaculans 568

Site:
position = -114
score = 7.73593
sequence = TACATACATTCGCGTATGTATGTA

Gene: Spro_1127: acriflavine resistance protein A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -114
score = 7.61545
sequence = TACATACATTCAAGTATGTATGTA

Gene: ECA1170: acriflavine resistance protein A
*
Edwardsiella tarda EIB202

Site:
position = -113
score = 7.40712
sequence = TACATGCATTGATGAATGTATGTA

Gene: ETAE_1011: acriflavine resistance protein A
*
Proteus mirabilis HI4320

Site:
position = -97
score = 7.64167
sequence = TACATACATTCATGTATGTTTGTA

Gene: PMI0132: acriflavine resistance protein A
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -101
score = 7.56311
sequence = TACATACATTCACGTATGTTTGTA

Gene: plu3851: acriflavine resistance protein A
acriflavine resistance protein A
acrB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0462: acriflavin resistance protein B
 
Salmonella typhimurium LT2

Gene: STM0475: acriflavin resistance protein B
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02689: acriflavin resistance protein B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00443: acriflavin resistance protein B
 
Enterobacter sp. 638

Gene: Ent638_0942: acriflavin resistance protein B
 
Erwinia amylovora ATCC 49946

Gene: EAM_1016: acriflavin resistance protein B
 
Yersinia pestis KIM

Gene: y1049: acriflavin resistance protein B
 
Serratia proteamaculans 568

Gene: Spro_1126: acriflavin resistance protein B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1169: acriflavin resistance protein B
 
Edwardsiella tarda EIB202

Gene: ETAE_1010: acriflavin resistance protein B
 
Proteus mirabilis HI4320

Gene: PMI0131: acriflavin resistance protein B
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3852: acriflavin resistance protein B
acriflavin resistance protein B
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD