Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 11 5
Salmonella typhimurium LT2 11 5
Citrobacter koseri ATCC BAA-895 11 5
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 8 4
Enterobacter sp. 638 11 5
Erwinia amylovora ATCC 49946 8 3
Yersinia pestis KIM 3 3
Serratia proteamaculans 568 8 3
Erwinia carotovora subsp. atroseptica SCRI1043 7 2
Edwardsiella tarda EIB202 9 4
Proteus mirabilis HI4320 7 2
Photorhabdus luminescens subsp. laumondii TTO1 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aroH
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -164
score = 5.25041
sequence = TGTACTAGAGAACTAGTGCA

Gene: b1704: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Salmonella typhimurium LT2

Site:
position = -163
score = 4.89393
sequence = TGTACTAGCAAACTAGTTTA

Gene: STM1347: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -173
score = 4.50121
sequence = TGTACTAACAAACTAGTGCA

Site:
position = -165
score = 4.51301
sequence = CAAACTAGTGCAAGAGTTCA

Gene: CKO_01728: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -162
score = 4.89388
sequence = TGTACTAATACACTAGTACA

Gene: KPN_02162: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Enterobacter sp. 638

Site:
position = -159
score = 5.01019
sequence = TGTACTAATATGCTAGTACA

Gene: Ent638_1743: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1928: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Serratia proteamaculans 568

Gene: Spro_2172: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1851: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Edwardsiella tarda EIB202

Site:
position = -135
score = 5.00508
sequence = TGTACTAGTAAGAAAGTACA

Gene: ETAE_1792: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Proteus mirabilis HI4320

Gene: PMI1423: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2630: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
CRON 2.
aroL
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -79
score = 5.64778
sequence = TGTACTAGTTTGATGGTATG

Gene: b0388: Shikimate kinase III (EC 2.7.1.71)
*
Salmonella typhimurium LT2

Site:
position = -79
score = 5.12954
sequence = TGTACTAGTTAGATGATATG

Gene: STM0388: Shikimate kinase III (EC 2.7.1.71)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -136
score = 5.3631
sequence = TGTACTAGTTTGGTGGTATG

Gene: CKO_02783: Shikimate kinase III (EC 2.7.1.71)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00332: Shikimate kinase III (EC 2.7.1.71)
*
Enterobacter sp. 638

Site:
position = -80
score = 5.59154
sequence = CGTACTAGTTTAATGGTATT

Gene: Ent638_0859: Shikimate kinase III (EC 2.7.1.71)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0932: Shikimate kinase III (EC 2.7.1.71)
 
Yersinia pestis KIM

Gene: y0972: Shikimate kinase III (EC 2.7.1.71)
 
Serratia proteamaculans 568

Gene: Spro_1018: Shikimate kinase III (EC 2.7.1.71)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1103: Shikimate kinase III (EC 2.7.1.71)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0371: Shikimate kinase III (EC 2.7.1.71)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1245: Shikimate kinase III (EC 2.7.1.71)
Shikimate kinase III (EC 2.7.1.71)
yaiA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0389: putative cytoplasmic protein
 
Salmonella typhimurium LT2

Gene: STM0389: putative cytoplasmic protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02782: putative cytoplasmic protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00333: putative cytoplasmic protein
 
Enterobacter sp. 638

Gene: Ent638_0860: putative cytoplasmic protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0933: putative cytoplasmic protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1021: putative cytoplasmic protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative cytoplasmic protein
aroM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0390: AroM family protein
 
Salmonella typhimurium LT2

Gene: STM0390: AroM family protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02781: AroM family protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00334: AroM family protein
 
Enterobacter sp. 638

Gene: Ent638_0861: AroM family protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0937: AroM family protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1025: AroM family protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
AroM family protein
 
CRON 3.
trpE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -183
score = 6.34681
sequence = CGAACTAGTTAACTAGTACG

Gene: b1264: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Salmonella typhimurium LT2

Site:
position = -186
score = 6.34681
sequence = CGAACTAGTTAACTAGTACG

Gene: STM1723: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -174
score = 6.34681
sequence = CGAACTAGTTAACTAGTACG

Gene: CKO_01340: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -198
score = 6.34681
sequence = CGAACTAGTTAACTAGTACG

Gene: KPN_01257: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Enterobacter sp. 638

Site:
position = -186
score = 6.34681
sequence = CGAACTAGTTAACTAGTACG

Gene: Ent638_2204: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Erwinia amylovora ATCC 49946

Site:
position = -192
score = 6.16903
sequence = CGAACCAGTTAACTAGTACA

Gene: EAM_1877: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Yersinia pestis KIM

Site:
position = -283
score = 6.2123
sequence = TGAACCAGTTAACTAGTACA

Gene: y2051: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Serratia proteamaculans 568

Site:
position = -219
score = 6.16903
sequence = CGAACCAGTTAACTAGTACA

Gene: Spro_2667: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -231
score = 6.16903
sequence = CGAACCAGTTAACTAGTACA

Gene: ECA2296: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Edwardsiella tarda EIB202

Site:
position = -222
score = 5.61383
sequence = GAAACTAGTTTACTAGTACG

Gene: ETAE_1535: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Proteus mirabilis HI4320

Site:
position = -243
score = 5.426
sequence = TAATCCAGTTTACTAGTACA

Gene: PMI1343: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -196
score = 5.82188
sequence = CGTTCCAGTTTACTAGTACA

Gene: plu2462: Anthranilate synthase, aminase component (EC 4.1.3.27)
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1263: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Salmonella typhimurium LT2

Gene: STM1724: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01339: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01256: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Enterobacter sp. 638

Gene: Ent638_2205: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 2
Erwinia amylovora ATCC 49946

Gene: EAM_1878: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: EAM_1879: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Yersinia pestis KIM
 2
Serratia proteamaculans 568

Gene: Spro_2668: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: Spro_2669: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 2
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2298: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: ECA2297: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 2
Edwardsiella tarda EIB202

Gene: ETAE_1534: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: ETAE_1533: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 2
Proteus mirabilis HI4320

Gene: PMI1344: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: PMI1345: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 2
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2463: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)

Gene: plu2464: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
Anthranilate synthase, amidotransferase component (EC 4.1.3.27) / Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
trpC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1262: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Salmonella typhimurium LT2

Gene: STM1725: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01338: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01255: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Enterobacter sp. 638

Gene: Ent638_2206: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1880: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Yersinia pestis KIM

Gene: y2049: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Serratia proteamaculans 568

Gene: Spro_2670: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2299: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Edwardsiella tarda EIB202

Gene: ETAE_1532: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Proteus mirabilis HI4320

Gene: PMI1346: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2465: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
trpB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1261: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Salmonella typhimurium LT2

Gene: STM1726: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01337: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01254: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Enterobacter sp. 638

Gene: Ent638_2207: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1881: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Yersinia pestis KIM

Gene: y2048: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Serratia proteamaculans 568

Gene: Spro_2671: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2300: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Edwardsiella tarda EIB202

Gene: ETAE_1531: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Proteus mirabilis HI4320

Gene: PMI1347: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2466: Tryptophan synthase beta chain (EC 4.2.1.20)
Tryptophan synthase beta chain (EC 4.2.1.20)
trpA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1260: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Salmonella typhimurium LT2

Gene: STM1727: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01336: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01253: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Enterobacter sp. 638

Gene: Ent638_2208: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1882: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Yersinia pestis KIM

Gene: y2047: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Serratia proteamaculans 568

Gene: Spro_2672: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2301: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Edwardsiella tarda EIB202

Gene: ETAE_1530: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Proteus mirabilis HI4320

Gene: PMI1348: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2467: Tryptophan synthase alpha chain (EC 4.2.1.20)
Tryptophan synthase alpha chain (EC 4.2.1.20)
 
CRON 4.
mtr
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -72
score = 5.87929
sequence = TGTACTCGTGTACTGGTACA

Gene: b3161: Tryptophan-specific transport protein
*
Salmonella typhimurium LT2

Site:
position = -72
score = 5.87929
sequence = TGTACTCGTGTACTGGTACA

Gene: STM3279: Tryptophan-specific transport protein
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -72
score = 5.43852
sequence = TGTACTCGCGTACTGGTACA

Gene: CKO_04558: Tryptophan-specific transport protein

Gene: CKO_02850: Tryptophan-specific transport protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -71
score = 5.87929
sequence = TGTACTCGTGTACTGGTACA

Gene: KPN_03569: Tryptophan-specific transport protein
*
Enterobacter sp. 638

Site:
position = -71
score = 5.44415
sequence = TGTACTCCTGTACTGGTACA

Gene: Ent638_3598: Tryptophan-specific transport protein
*
Erwinia amylovora ATCC 49946

Site:
position = -112
score = 4.78562
sequence = TGTACTAGTTCGATGGTGTG

Gene: EAM_1150: Tryptophan-specific transport protein
*
Yersinia pestis KIM

Site:
position = -139
score = 4.99534
sequence = TGTACCATTCAGCTAGTACA

Gene: y2900: Tryptophan-specific transport protein
*
Serratia proteamaculans 568

Site:
position = -58
score = 5.3094
sequence = TGTACCATTGAGCTAGTACA

Gene: Spro_3236: Tryptophan-specific transport protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0872: Tryptophan-specific transport protein
*
Edwardsiella tarda EIB202

Site:
position = -48
score = 4.78289
sequence = CGTACCATTGCGCTAGTACA

Gene: ETAE_2287: Tryptophan-specific transport protein
 
Proteus mirabilis HI4320

Gene: PMI0836: Tryptophan-specific transport protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2860: Tryptophan-specific transport protein
Tryptophan-specific transport protein
 
CRON 5.
trpR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -66
score = 5.31561
sequence = CGTACTCTTTAGCGAGTACA

Gene: b4393: Trp operon repressor
*
Salmonella typhimurium LT2

Site:
position = -34
score = 5.58214
sequence = TGTACTCGTGTAACAGTACA

Gene: STM4583: Trp operon repressor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -97
score = 5.98197
sequence = CGTACTCGTTAAAGAGTACA

Gene: CKO_03393: Trp operon repressor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -65
score = 5.74035
sequence = TGTACTCGTTGAAGAGTACA

Gene: KPN_04848: Trp operon repressor
*
Enterobacter sp. 638

Site:
position = 3
score = 5.48002
sequence = TGTACTcGTcAAagAGTACA

Gene: Ent638_0554: Trp operon repressor
*
Erwinia amylovora ATCC 49946

Site:
position = -33
score = 6.21402
sequence = TGTACTAGTTAAATAGTATG

Gene: EAM_0634: Trp operon repressor
*
Yersinia pestis KIM

Site:
position = -24
score = 6.061
sequence = TGTACTAGTTAAATAGTACT

Gene: y3726: Trp operon repressor
*
Serratia proteamaculans 568

Site:
position = -30
score = 6.21402
sequence = TGTACTAGTTAAATAGTATG

Gene: Spro_0676: Trp operon repressor
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -30
score = 6.17075
sequence = CGTACTAGTTAAATAGTATG

Gene: ECA3899: Trp operon repressor
*
Edwardsiella tarda EIB202

Site:
position = -44
score = 5.56645
sequence = TGTACTCGTTGAATAGTTCA

Gene: ETAE_0543: Trp operon repressor
*
Proteus mirabilis HI4320

Site:
position = -39
score = 5.17674
sequence = TGTACTAGTTTATGAGTGTG

Gene: PMI3714: Trp operon repressor
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -34
score = 6.21402
sequence = TGTACTAGTTAAATAGTATG

Gene: plu0557: Trp operon repressor
Trp operon repressor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD