Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 6 1
Bacillus amyloliquefaciens FZB42 6 1
Bacillus pumilus SAFR-032 6 1
Bacillus licheniformis DSM 13 6 1
Anoxybacillus flavithermus WK1 6 1
Geobacillus kaustophilus HTA426 6 1
Bacillus cereus ATCC 14579 5 1
Bacillus halodurans C-125 6 1
Bacillus clausii KSM-K16 6 1
Oceanobacillus iheyensis HTE831 6 1
Paenibacillus sp. JDR-2 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -36
score = 6.34233
sequence = CTATGTAAACGGTTACATAA

Gene: BSU35910: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -35
score = 6.34233
sequence = TTATGTAAACGGTTACATAG

Gene: RBAM_033080: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus pumilus SAFR-032

Site:
position = -40
score = 6.55767
sequence = TTGTGTAAACGGTTACACAT

Gene: BPUM_3263: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus licheniformis DSM 13

Site:
position = 17
score = 6.51405
sequence = TTATGTAAACGGTTACACAA

Gene: BLi03840: Transcriptional repressor of ribose utilization, LacI family
*
Anoxybacillus flavithermus WK1

Site:
position = -36
score = 6.65469
sequence = ATATGTAACCGGTTACAGAA

Gene: Aflv_2673: Transcriptional repressor of ribose utilization, LacI family
*
Geobacillus kaustophilus HTA426

Site:
position = -43
score = 6.76675
sequence = ATGTGTAACCGGTTACACAT

Gene: GK3231: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus cereus ATCC 14579

Site:
position = -37
score = 6.11595
sequence = TTCTGTAAACGGTTACATGA

Gene: BC0659: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus halodurans C-125

Site:
position = -35
score = 6.69831
sequence = ATCTGTAACCGGTTACACAT

Gene: BH3727: Transcriptional repressor of ribose utilization, LacI family
*
Bacillus clausii KSM-K16

Site:
position = -35
score = 6.38627
sequence = ATCTGTAACCGGTTACATGT

Gene: ABC3549: Transcriptional repressor of ribose utilization, LacI family
*
Oceanobacillus iheyensis HTE831

Site:
position = -42
score = 5.99785
sequence = ATCTGAAACCGGTTCCATAT

Gene: OB2577: Transcriptional repressor of ribose utilization, LacI family
*
Paenibacillus sp. JDR-2

Site:
position = -37
score = 6.29727
sequence = ATGTGTAAACGGTTCCACAT

Gene: Pjdr2_3988: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
rbsK
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU35920: Ribokinase (EC 2.7.1.15)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033090: Ribokinase (EC 2.7.1.15)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3264: Ribokinase (EC 2.7.1.15)
 
Bacillus licheniformis DSM 13

Gene: BLi03841: Ribokinase (EC 2.7.1.15)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2672: Ribokinase (EC 2.7.1.15)
 
Geobacillus kaustophilus HTA426

Gene: GK3230: Ribokinase (EC 2.7.1.15)
 
Bacillus cereus ATCC 14579

Gene: BC0660: Ribokinase (EC 2.7.1.15)
 
Bacillus halodurans C-125

Gene: BH3728: Ribokinase (EC 2.7.1.15)
 3
Bacillus clausii KSM-K16

Gene: ABC3643: Ribokinase (EC 2.7.1.15)

Gene: ABC3548: Ribokinase (EC 2.7.1.15)

Gene: ABC3603: Ribokinase (EC 2.7.1.15)
 
Oceanobacillus iheyensis HTE831

Gene: OB2576: Ribokinase (EC 2.7.1.15)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3987: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU35930: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033100: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3265: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus licheniformis DSM 13

Gene: BLi03842: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2671: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Geobacillus kaustophilus HTA426

Gene: GK3229: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus cereus ATCC 14579

Gene: BC0661: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus halodurans C-125

Gene: BH3729: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Bacillus clausii KSM-K16

Gene: ABC3547: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2575: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3986: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU35940: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033110: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3266: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus licheniformis DSM 13

Gene: BLi03843: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2670: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Geobacillus kaustophilus HTA426

Gene: GK3228: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus cereus ATCC 14579

Gene: BC0662: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus halodurans C-125

Gene: BH3730: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Bacillus clausii KSM-K16

Gene: ABC3546: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2574: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3985: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU35950: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033120: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3267: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus licheniformis DSM 13

Gene: BLi03844: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2669: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Geobacillus kaustophilus HTA426

Gene: GK3227: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus cereus ATCC 14579

Gene: BC0663: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus halodurans C-125

Gene: BH3731: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Bacillus clausii KSM-K16

Gene: ABC3545: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2573: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3984: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU35960: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033130: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3268: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Bacillus licheniformis DSM 13

Gene: BLi03845: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2668: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Geobacillus kaustophilus HTA426

Gene: GK3226: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3732: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Bacillus clausii KSM-K16

Gene: ABC3544: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2572: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3983: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD