Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RutR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 10 3
Salmonella typhimurium LT2 2 1
Citrobacter koseri ATCC BAA-895 2 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 10 3
Enterobacter sp. 638 9 2
Erwinia amylovora ATCC 49946 2 1
Yersinia pestis KIM
Serratia proteamaculans 568 7 2
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rutA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -126
score = 6.18212
sequence = TTTTGACCGTTTAGTCCACT

Gene: b1012: Pyrimidine oxygenase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -181
score = 5.96368
sequence = TTTTGACCATCCAGTCCACT

Gene: KPN_01038: Pyrimidine oxygenase
*
Enterobacter sp. 638

Site:
position = -185
score = 6.09165
sequence = TTTTGACCATTCAGTCCACT

Gene: Ent638_1525: Pyrimidine oxygenase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -187
score = 5.81869
sequence = TTTTGACCAAATGGTCTGTT

Gene: Spro_1823: Pyrimidine oxygenase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Pyrimidine oxygenase
rutB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1011: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01037: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Enterobacter sp. 638

Gene: Ent638_1524: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1822: Peroxyureidoacrylate / ureidoacrylate amido hydrolase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1010: Aminoacrylate peracid reductase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01036: Aminoacrylate peracid reductase
 
Enterobacter sp. 638

Gene: Ent638_1523: Aminoacrylate peracid reductase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1821: Aminoacrylate peracid reductase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Aminoacrylate peracid reductase
rutD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1009: Aminoacrylate hydrolase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01035: Aminoacrylate hydrolase
 
Enterobacter sp. 638

Gene: Ent638_1522: Aminoacrylate hydrolase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1820: Aminoacrylate hydrolase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Aminoacrylate hydrolase
rutE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1008: 3-hydroxy propionic acid dehydrogenase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01034: 3-hydroxy propionic acid dehydrogenase
 
Enterobacter sp. 638

Gene: Ent638_1521: 3-hydroxy propionic acid dehydrogenase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
3-hydroxy propionic acid dehydrogenase
rutF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1007: Flavin reductase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01033: Flavin reductase
 
Enterobacter sp. 638

Gene: Ent638_1520: Flavin reductase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1819: Flavin reductase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Flavin reductase
rutG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1006: Uracil permease
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01032: Uracil permease
 
Enterobacter sp. 638

Gene: Ent638_1519: Uracil permease
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1818: Uracil permease
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Uracil permease
 
CRON 2.
carA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -294
score = 6.52383
sequence = TTTTGACCATTTGGTCCACT

Gene: b0032: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
*
Salmonella typhimurium LT2

Site:
position = -294
score = 6.50468
sequence = ATTTGACCATTTGGTCCACT

Gene: STM0066: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -268
score = 6.3552
sequence = TTTTGACCAAATGGTCCACT

Gene: CKO_03351: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -267
score = 6.39586
sequence = TTTTGACCATCTGGTCCACT

Gene: KPN_00040: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
*
Enterobacter sp. 638

Site:
position = -294
score = 5.84697
sequence = TTTTGACCATTTGGTCTGGT

Gene: Ent638_0591: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
*
Erwinia amylovora ATCC 49946

Site:
position = -297
score = 6.21231
sequence = TTCTGACCATTTGGTCCACT

Gene: EAM_0660: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Yersinia pestis KIM

Gene: y3693: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Serratia proteamaculans 568

Gene: Spro_0713: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3871: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Edwardsiella tarda EIB202

Gene: ETAE_0593: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Proteus mirabilis HI4320

Gene: PMI0020: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0603: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
carB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0033: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Salmonella typhimurium LT2

Gene: STM0067: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03350: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00041: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Enterobacter sp. 638

Gene: Ent638_0592: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0661: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Yersinia pestis KIM

Gene: y3692: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Serratia proteamaculans 568

Gene: Spro_0714: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3870: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Edwardsiella tarda EIB202

Gene: ETAE_0594: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Proteus mirabilis HI4320

Gene: PMI0021: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0604: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
 
CRON 3.
rutR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -124
score = 4.34619
sequence = AGTGGACTAAACGGTCAAAA

Gene: b1013: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Salmonella typhimurium LT2

Gene: STM1122: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02045: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -123
score = 4.16644
sequence = AGTGGACTGGATGGTCAAAA

Gene: KPN_01039: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Enterobacter sp. 638

Gene: Ent638_1539: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Erwinia amylovora ATCC 49946

Gene: EAM_1396: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -118
score = 4.95994
sequence = AACAGACCATTTGGTCAAAA

Gene: Spro_1824: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD