Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Enterobacteriales  

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 61 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 10 5
Salmonella typhimurium LT2 10 5
Citrobacter koseri ATCC BAA-895 8 4
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 5 3
Enterobacter sp. 638 5 3
Erwinia amylovora ATCC 49946 5 2
Yersinia pestis KIM 3 3
Serratia proteamaculans 568 12 5
Erwinia carotovora subsp. atroseptica SCRI1043 5 5
Edwardsiella tarda EIB202 2 1
Proteus mirabilis HI4320 4 2
Photorhabdus luminescens subsp. laumondii TTO1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gadA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02084: Gluconate 2-dehydrogenase subunit (EC 1.1.99.3)
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -133
score = 5.80241
sequence = TATTGTTACCGGTAACAGTC

Gene: EAM_0336: Gluconate 2-dehydrogenase subunit (EC 1.1.99.3)
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -131
score = 5.93391
sequence = ATAAGTTACCGGTAACATTG

Gene: Spro_2136: Gluconate 2-dehydrogenase subunit (EC 1.1.99.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Gluconate 2-dehydrogenase subunit (EC 1.1.99.3)
gadB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02083: Gluconate 2-dehydrogenase, flavoprotein subunit (EC 1.1.99.3)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_0337: Gluconate 2-dehydrogenase, flavoprotein subunit (EC 1.1.99.3)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2137: Gluconate 2-dehydrogenase, flavoprotein subunit (EC 1.1.99.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Gluconate 2-dehydrogenase, flavoprotein subunit (EC 1.1.99.3)
gadC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02082: Gluconate 2-dehydrogenase, cytochrome C subunit (EC 1.1.99.3)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_0338: Gluconate 2-dehydrogenase, cytochrome C subunit (EC 1.1.99.3)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2138: Gluconate 2-dehydrogenase, cytochrome C subunit (EC 1.1.99.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Gluconate 2-dehydrogenase, cytochrome C subunit (EC 1.1.99.3)
 
CRON 2.
gntK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -48
score = 5.76626
sequence = AACAGTTACCCGTAACATTT

Site:
position = -61
score = 6.36966
sequence = CAATGTTACCGATAACAGTT

Gene: b3437: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Salmonella typhimurium LT2

Site:
position = -48
score = 5.1261
sequence = AACAGTTACCCGTAACAAAT

Site:
position = -61
score = 6.36966
sequence = CAATGTTACCGATAACAGTT

Gene: STM3542: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -101
score = 6.36966
sequence = CAATGTTACCGATAACAGTT

Site:
position = -88
score = 5.6094
sequence = AACAGTTACCCGTAACAATT

Gene: CKO_04856: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -58
score = 6.36966
sequence = CAATGTTACCGATAACAGTT

Site:
position = -45
score = 5.6094
sequence = AACAGTTACCCGTAACAATT

Gene: KPN_03801: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Enterobacter sp. 638

Site:
position = -49
score = 5.77929
sequence = CAATGTTACCGATAACTGTT

Site:
position = -36
score = 6.00818
sequence = AACTGTTACCCGTAACAATT

Gene: Ent638_3845: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Erwinia amylovora ATCC 49946

Site:
position = -59
score = 5.85384
sequence = CAATGTTACCGATAACAACG

Gene: EAM_3275: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Yersinia pestis KIM

Site:
position = -91
score = 5.63222
sequence = ATTTGTTACCGGTATCATGA

Site:
position = -77
score = 5.53916
sequence = TCATGATACCGGTAACATGG

Gene: y3876: Thermoresistant gluconokinase (EC 2.7.1.12)
*2
Serratia proteamaculans 568

Gene: Spro_4650: Thermoresistant gluconokinase (EC 2.7.1.12)

Site:
position = -73
score = 6.43468
sequence = CAATGTTACCGATAACATGT

Site:
position = -59
score = 5.50156
sequence = ACATGTTACCGGTAACAAAC

Gene: Spro_4497: Thermoresistant gluconokinase (EC 2.7.1.12)
*2
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -91
score = 5.44127
sequence = ACTTGTTACCGGTATCATGA

Site:
position = -77
score = 5.08722
sequence = TCATGATACCGGTAACGTGA

Gene: ECA1839: Thermoresistant gluconokinase (EC 2.7.1.12)

Site:
position = -77
score = 5.27232
sequence = ATATGATACGGGTAACATGT

Gene: ECA4159: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Edwardsiella tarda EIB202

Site:
position = -58
score = 5.4073
sequence = AACAGTTACCAGTAACATTG

Site:
position = -71
score = 5.993
sequence = GAATGTTACCCATAACAGTT

Gene: ETAE_0135: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Proteus mirabilis HI4320

Site:
position = -67
score = 6.38587
sequence = TAATGTTACCCGTAACAGTT

Site:
position = -54
score = 5.29657
sequence = AACAGTTACGGGTAACATTA

Gene: PMI2673: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -52
score = 5.91652
sequence = AACAGTTACCGGTAACATTT

Site:
position = -65
score = 6.36966
sequence = TAATGTTACCGATAACAGTT

Gene: plu0497: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
gntU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4476: Low-affinity gluconate transporter
 
Salmonella typhimurium LT2

Gene: STM3541: Low-affinity gluconate transporter
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04855: Low-affinity gluconate transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03800: Low-affinity gluconate transporter
 
Enterobacter sp. 638

Gene: Ent638_3844: Low-affinity gluconate transporter
 
Erwinia amylovora ATCC 49946

Gene: EAM_3274: Low-affinity gluconate transporter
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4498: Low-affinity gluconate transporter
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -100
score = 5.45063
sequence = ACATGTTACCCGTATCATAT

Gene: ECA4158: Low-affinity gluconate transporter
 
Edwardsiella tarda EIB202

Gene: ETAE_0134: Low-affinity gluconate transporter
 
Proteus mirabilis HI4320

Gene: PMI2672: Low-affinity gluconate transporter
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0498: Low-affinity gluconate transporter
Low-affinity gluconate transporter
edd
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -212
score = 6.29244
sequence = TTATTTTACCGGTAACATGA

Gene: b1851: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Salmonella typhimurium LT2

Site:
position = -212
score = 6.06605
sequence = GTATTTTACCGGTAACATGA

Gene: STM1885: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -211
score = 6.29244
sequence = TTATTTTACCGGTAACATGA

Gene: CKO_01115: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -211
score = 6.29244
sequence = TTATTTTACCGGTAACATGA

Site:
position = -2
score = 5.41825
sequence = CAATGTTACGGGTAACAAAT

Gene: KPN_02366: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Enterobacter sp. 638

Site:
position = -210
score = 6.29244
sequence = TTATTTTACCGGTAACATGA

Gene: Ent638_2420: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1654: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Serratia proteamaculans 568

Gene: Spro_4499: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -359
score = 5.85753
sequence = CATTGTTACCGGTATCATTT

Gene: ECA1836: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Edwardsiella tarda EIB202

Gene: ETAE_1451: 6-phosphogluconate dehydratase (EC 4.2.1.12)
*
Proteus mirabilis HI4320

Site:
position = -111
score = 5.07794
sequence = GCTTGTTACCCGTAACAATG

Site:
position = -96
score = 6.44429
sequence = CAATGTTACCGGTAACAAGT

Gene: PMI2760: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Photorhabdus luminescens subsp. laumondii TTO1
6-phosphogluconate dehydratase (EC 4.2.1.12)
eda
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1850: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Salmonella typhimurium LT2

Gene: STM1884: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01116: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02365: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Enterobacter sp. 638

Gene: Ent638_2419: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2243: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 2
Serratia proteamaculans 568

Gene: Spro_2767: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

Gene: Spro_4500: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2478: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Edwardsiella tarda EIB202

Gene: ETAE_1452: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Proteus mirabilis HI4320

Gene: PMI2761: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Photorhabdus luminescens subsp. laumondii TTO1
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -178
score = 5.8539
sequence = AGATGTTACCCGTATCATTC

Site:
position = -37
score = 4.89779
sequence = TGACGTTACCCATAACAAAT

Gene: b3415: High-affinity H+/gluconate symporter
*
Salmonella typhimurium LT2

Site:
position = -178
score = 5.95688
sequence = ATATGTTACCCGTATCATTC

Site:
position = -37
score = 4.72978
sequence = TGACGTTACCCATAACAAAG

Gene: STM3512: High-affinity H+/gluconate symporter
*
Citrobacter koseri ATCC BAA-895

Site:
position = -178
score = 5.95688
sequence = ATATGTTACCCGTATCATTC

Site:
position = -37
score = 4.89779
sequence = CGACGTTACCCATAACAAAT

Gene: CKO_04836: High-affinity H+/gluconate symporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -180
score = 5.46231
sequence = ACATGTTACCCGTATCATCC

Site:
position = -36
score = 4.89779
sequence = TGACGTTACCCATAACAAAT

Gene: KPN_03785: High-affinity H+/gluconate symporter
*
Enterobacter sp. 638

Site:
position = -178
score = 5.8539
sequence = AGATGTTACCCGTATCATTC

Site:
position = -37
score = 4.89779
sequence = TGACGTTACCCATAACAAAT

Gene: Ent638_3828: High-affinity H+/gluconate symporter
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -159
score = 6.04242
sequence = CCATGTTACCGGTATCATGA

Site:
position = -145
score = 5.11464
sequence = TCATGATACCGGTAACAAAT

Gene: y3875: High-affinity H+/gluconate symporter
*
Serratia proteamaculans 568

Site:
position = -185
score = 5.33828
sequence = GGTTGTTACCGGTATCATGA

Site:
position = -171
score = 5.42993
sequence = TCATGATACCGGTAACAATG

Gene: Spro_4651: High-affinity H+/gluconate symporter
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -239
score = 5.46395
sequence = TCACGTTACCGGTATCATGA

Site:
position = -225
score = 5.55031
sequence = TCATGATACCGGTAACAAGT

Gene: ECA1840: High-affinity H+/gluconate symporter
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
High-affinity H+/gluconate symporter
 
CRON 3.
sdxX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -237
score = 5.71908
sequence = TCACGTTACCGGTAACATGT

Gene: y1651: putative 2-ketogluconate dehydrogenase
 
Serratia proteamaculans 568

Gene: Spro_2497: putative 2-ketogluconate dehydrogenase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative 2-ketogluconate dehydrogenase
 
CRON 4.
idnD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -146
score = 3.82217
sequence = TAtTtcTACtGaTAAgAaTT

Site:
position = -116
score = 3.7844
sequence = TcAcGTTAtgcGTAACATag

Gene: b4267: L-idonate 5-dehydrogenase (EC 1.1.1.264)
*
Salmonella typhimurium LT2

Site:
position = -116
score = 4.2677
sequence = TcAcGTTAtgcGTAACATTg

Gene: STM4484: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3287: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnO
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4266: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Salmonella typhimurium LT2

Gene: STM4483: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -39
score = 4.79507
sequence = TACAGTTACGCGTAACAGCT

Gene: CKO_02793: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1645: Gluconate 5-dehydrogenase (EC 1.1.1.69)
*
Serratia proteamaculans 568

Site:
position = -120
score = 4.1697
sequence = TcAcGTTAaaGGTAACAgcT

Gene: Spro_3288: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Gluconate 5-dehydrogenase (EC 1.1.1.69)
idnT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4265: L-idonate and D-gluconate transporter
 
Salmonella typhimurium LT2

Gene: STM4482: L-idonate and D-gluconate transporter
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-idonate and D-gluconate transporter
idnR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4264: L-idonate utilization transcriptional regulator IdnR, LacI family
 
Salmonella typhimurium LT2

Gene: STM4481: L-idonate utilization transcriptional regulator IdnR, LacI family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02791: L-idonate utilization transcriptional regulator IdnR, LacI family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1650: L-idonate utilization transcriptional regulator IdnR, LacI family
*
Serratia proteamaculans 568

Site:
position = -169
score = 4.37405
sequence = AGCTGTTACCTTTAACGTGA

Gene: Spro_3289: L-idonate utilization transcriptional regulator IdnR, LacI family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-idonate utilization transcriptional regulator IdnR, LacI family
uhpC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02792: Predicted sugar-phosphate permease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Predicted sugar-phosphate permease
idnK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -119
score = 4.96145
sequence = CTATGTTACGCATAACGTGA

Gene: b4268: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Salmonella typhimurium LT2

Site:
position = -119
score = 5.0741
sequence = CAATGTTACGCATAACGTGA

Gene: STM4485: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1646: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Thermoresistant gluconokinase (EC 2.7.1.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD