Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Synechococcus sp. PCC 7002 7 3
Synechocystis sp. PCC 6803 5 3
Cyanothece sp. ATCC 51142 27 17
Cyanothece sp. PCC 8801 13 9
Cyanothece sp. PCC 7425 9 5
Microcystis aeruginosa NIES-843 10 5
Nostoc sp. PCC 7120 22 8
Trichodesmium erythraeum IMS101 9 6
Synechococcus elongatus PCC 7942 7 3
Prochlorococcus marinus str. MIT 9313 3 2
Synechococcus sp. JA-3-3Ab 4 1
Synechococcus sp. WH 8102 4 3
Gloeobacter violaceus PCC 7421 5 3
Thermosynechococcus elongatus BP-1 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cce_1484
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -40
score = 6.68012
sequence = ACTAGAATGATTATCATTATCAT

Gene: cce_1484: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*2
Cyanothece sp. PCC 8801

Site:
position = -53
score = 4.90046
sequence = ACAATTATGAAAATCATTATGAG

Gene: PCC8801_2483: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein

Site:
position = -40
score = 6.95963
sequence = ATTAGAATGATTATCATTATCAT

Gene: PCC8801_0773: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*
Cyanothece sp. PCC 7425

Site:
position = -29
score = 5.20204
sequence = TTGAAAATGAGAATGGTTCTTAT

Gene: Cyan7425_0822: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_31440: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101

Gene: Tery_3218: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*2
Synechococcus elongatus PCC 7942

Site:
position = -59
score = 4.89761
sequence = TAGGGAATGATAACGATTCTCAA

Gene: Synpcc7942_1316: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein

Gene: Synpcc7942_2575: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*
Prochlorococcus marinus str. MIT 9313

Site:
position = -34
score = 5.95581
sequence = ATAAAAATGGGAATCATTCTCAT

Gene: PMT2203: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1680: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*
Synechococcus sp. WH 8102

Site:
position = 37
score = 6.32587
sequence = GTAAAAATGATAATCATTCTCAT

Gene: SYNW0971: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
*2
Gloeobacter violaceus PCC 7421

Site:
position = -6
score = 5.29863
sequence = TCTAGAATGAGAATCATTCTTGA

Gene: glr1694: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein

Gene: glr3311: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
 
Thermosynechococcus elongatus BP-1
Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1485
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -31
score = 6.68012
sequence = ATGATAATGATAATCATTCTAGT

Gene: cce_1485: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
*2
Cyanothece sp. PCC 8801

Site:
position = -32
score = 6.95963
sequence = ATGATAATGATAATCATTCTAAT

Gene: PCC8801_0774: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein

Site:
position = -84
score = 4.90046
sequence = CTCATAATGATTTTCATAATTGT

Gene: PCC8801_2484: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
*
Cyanothece sp. PCC 7425

Site:
position = -29
score = 5.27785
sequence = ATAAGAATTATTCTCATTTTCAC

Gene: Cyan7425_0794: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_04690: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101

Gene: Tery_3219: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 2
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1317: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein

Gene: Synpcc7942_2574: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
*
Prochlorococcus marinus str. MIT 9313

Site:
position = -111
score = 5.95581
sequence = ATGAGAATGATTCCCATTTTTAT

Gene: PMT2202: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1679: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
*
Synechococcus sp. WH 8102

Site:
position = -83
score = 6.32587
sequence = ATGAGAATGATTATCATTTTTAC

Gene: SYNW0970: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 2
Gloeobacter violaceus PCC 7421

Gene: gll3310: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein

Gene: glr3312: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
 
Thermosynechococcus elongatus BP-1
Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
cce_1486
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142

Gene: cce_1486: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_4926: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_08530: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Nostoc sp. PCC 7120
*
Trichodesmium erythraeum IMS101

Site:
position = -287
score = 5.24377
sequence = ATTATAATCATATTTATTATTAA

Gene: Tery_3358: Predicted Mn/Zn chelate ABC transporter, permease protein
 2
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1318: Predicted Mn/Zn chelate ABC transporter, permease protein

Gene: Synpcc7942_2573: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT2201: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1678: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Synechococcus sp. WH 8102

Gene: SYNW0969: Predicted Mn/Zn chelate ABC transporter, permease protein
*3
Gloeobacter violaceus PCC 7421

Site:
position = -56
score = 5.29863
sequence = TCAAGAATGATTCTCATTCTAGA

Gene: gll1693: Predicted Mn/Zn chelate ABC transporter, permease protein

Gene: gll3309: Predicted Mn/Zn chelate ABC transporter, permease protein

Gene: glr3313: Predicted Mn/Zn chelate ABC transporter, permease protein
 
Thermosynechococcus elongatus BP-1
Predicted Mn/Zn chelate ABC transporter, permease protein
 
CRON 2.
hisI2
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -37
score = 5.42518
sequence = ATGATAATGATTATCAAAATTGA

Gene: cce_4845: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
*
Trichodesmium erythraeum IMS101

Site:
position = -37
score = 4.80538
sequence = AGGATAATGATTATTAAAATTGA

Gene: Tery_2490: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
CRON 3.
ompZ
 
Synechococcus sp. PCC 7002
*
Synechocystis sp. PCC 6803

Site:
position = -118
score = 6.72536
sequence = ATGATAATGATTATCATTATTTA

Gene: sll1550: Predicted zink uptake outer membrane protein
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_0823: Predicted zink uptake outer membrane protein
*
Microcystis aeruginosa NIES-843

Site:
position = -40
score = 5.52967
sequence = CTGAGAACAATAATCATTCTTGT

Gene: MAE_10010: Predicted zink uptake outer membrane protein
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
*4
Synechococcus elongatus PCC 7942

Site:
position = -37
score = 6.10867
sequence = ATGAGAATAATAATCATTTTTAG

Gene: Synpcc7942_1463: Predicted zink uptake outer membrane protein

Gene: Synpcc7942_1464: Predicted zink uptake outer membrane protein

Gene: Synpcc7942_1635: Predicted zink uptake outer membrane protein

Gene: Synpcc7942_1607: Predicted zink uptake outer membrane protein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1411: Predicted zink uptake outer membrane protein
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
*
Thermosynechococcus elongatus BP-1

Site:
position = -84
score = 6.16162
sequence = AGTAGAATGATAATCATTACAAT

Gene: tlr1246: Predicted zink uptake outer membrane protein
Predicted zink uptake outer membrane protein
 
CRON 4.
smtA
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A2563: Predicted zinc-binding metallothionein
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142

Gene: cce_2496: Predicted zinc-binding metallothionein
*
Cyanothece sp. PCC 8801

Site:
position = -152
score = 5.74129
sequence = TCTAGAATGATAATCACTCTCAT

Gene: PCC8801_0861: Predicted zinc-binding metallothionein
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1290: Predicted zinc-binding metallothionein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. WH 8102

Site:
position = -105
score = 6.17488
sequence = CCGATAATGATTATCATTCTTTT

Site:
position = -79
score = 5.49836
sequence = CCAATAATGAGAATTATTCTTAT

Gene: SYNW0359: Predicted zinc-binding metallothionein
 
Gloeobacter violaceus PCC 7421

Gene: gsl3430: Predicted zinc-binding metallothionein
 
Thermosynechococcus elongatus BP-1

Gene: tsl1016: Predicted zinc-binding metallothionein
Predicted zinc-binding metallothionein
 
CRON 5.
thrS2
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*2
Cyanothece sp. ATCC 51142

Site:
position = 28
score = 6.3225
sequence = ATGATAATGATTATTATTACAAT

Gene: cce_4835: Threonyl-tRNA synthetase (EC 6.1.1.3)

Site:
position = 81
score = 6.71995
sequence = TTGATAATGATTATCATTTTTAT

Site:
position = 127
score = 6.94326
sequence = ATAATAATGATTATCATTTTTAT

Gene: cce_1495: Threonyl-tRNA synthetase (EC 6.1.1.3)
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
*
Microcystis aeruginosa NIES-843

Site:
position = -34
score = 6.00144
sequence = GCTACAATGATAATCATTATCAT

Gene: MAE_31590: Threonyl-tRNA synthetase (EC 6.1.1.3)
*
Nostoc sp. PCC 7120

Site:
position = -28
score = 5.87463
sequence = ATGATAACGATTCTCATTATTTA

Gene: all4723: Threonyl-tRNA synthetase (EC 6.1.1.3)
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Threonyl-tRNA synthetase (EC 6.1.1.3)
yciC
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*4
Cyanothece sp. ATCC 51142

Site:
position = -80
score = 6.3225
sequence = ATTGTAATAATAATCATTATCAT

Site:
position = -52
score = 5.30237
sequence = CGTAAATTGATAATCATTATCAA

Gene: cce_4834: Putative zinc chaperone, COG0523 family

Site:
position = -46
score = 5.62245
sequence = TTAAGAACGATTATCGTTATAGT

Gene: cce_4833: Putative zinc chaperone, COG0523 family

Gene: cce_1500: Putative zinc chaperone, COG0523 family

Gene: cce_3555: Putative zinc chaperone, COG0523 family
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0865: Putative zinc chaperone, COG0523 family
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_1081: Putative zinc chaperone, COG0523 family
 
Microcystis aeruginosa NIES-843

Gene: MAE_31600: Putative zinc chaperone, COG0523 family
 
Nostoc sp. PCC 7120

Gene: all4722: Putative zinc chaperone, COG0523 family
*
Trichodesmium erythraeum IMS101

Site:
position = -255
score = 5.17916
sequence = ATTATGATAATAATTATTGCAAT

Gene: Tery_4617: Putative zinc chaperone, COG0523 family
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
*
Thermosynechococcus elongatus BP-1

Site:
position = -36
score = 5.71652
sequence = ATGAGAATGATTCTCTTTTTCTT

Gene: tlr2276: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
folE2
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_G0128: GTP cyclohydrolase I (EC 3.5.4.16)
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -43
score = 5.41907
sequence = TTGAGAACGATTATCATTTTATC

Gene: cce_1501: GTP cyclohydrolase I (EC 3.5.4.16)
*
Cyanothece sp. PCC 8801

Site:
position = -50
score = 5.89161
sequence = TTGAGAACGATTATCATTTTAAA

Gene: PCC8801_0864: GTP cyclohydrolase I (EC 3.5.4.16)
 
Cyanothece sp. PCC 7425
*
Microcystis aeruginosa NIES-843

Site:
position = -323
score = 5.85518
sequence = ATGATAACGATTATCATTCTAGG

Gene: MAE_22860: GTP cyclohydrolase I (EC 3.5.4.16)
 
Nostoc sp. PCC 7120

Gene: all4721: GTP cyclohydrolase I (EC 3.5.4.16)
 
Trichodesmium erythraeum IMS101

Gene: Tery_4616: GTP cyclohydrolase I (EC 3.5.4.16)
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
GTP cyclohydrolase I (EC 3.5.4.16)
hemB2
*
Synechococcus sp. PCC 7002

Site:
position = -25
score = 5.9318
sequence = TCGAGAATGATTATCATTTTTTA

Gene: SYNPCC7002_G0127: Porphobilinogen synthase (EC 4.2.1.24)
 
Synechocystis sp. PCC 6803
*2
Cyanothece sp. ATCC 51142

Site:
position = -78
score = 7.11365
sequence = ATAATAATGATTATCATTATTAT

Site:
position = -32
score = 5.91941
sequence = ATAATAATGATTATCGTTTCTAA

Gene: cce_1489: Porphobilinogen synthase (EC 4.2.1.24)

Site:
position = -72
score = 6.01902
sequence = TAAATAATAATAATCATTCTCGT

Site:
position = -46
score = 6.63211
sequence = ATAATAATGATTATCATTTTGAT

Gene: cce_4852: Porphobilinogen synthase (EC 4.2.1.24)
*
Cyanothece sp. PCC 8801

Site:
position = -72
score = 5.50274
sequence = TTGATAATGATTATCATTCCGTG

Site:
position = -32
score = 6.68613
sequence = ATAATAATGATTATCATTTTTAA

Gene: PCC8801_0777: Porphobilinogen synthase (EC 4.2.1.24)
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843

Gene: MAE_22850: Porphobilinogen synthase (EC 4.2.1.24)
*
Nostoc sp. PCC 7120

Site:
position = -31
score = 5.71889
sequence = ATGATAATGGTTATCAATCTTGT

Gene: all4725: Porphobilinogen synthase (EC 4.2.1.24)
 
Trichodesmium erythraeum IMS101

Gene: Tery_4608: Porphobilinogen synthase (EC 4.2.1.24)
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1547: Porphobilinogen synthase (EC 4.2.1.24)
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2762: Porphobilinogen synthase (EC 4.2.1.24)
 
Synechococcus sp. WH 8102

Gene: SYNW1933: Porphobilinogen synthase (EC 4.2.1.24)
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1

Gene: tll0422: Porphobilinogen synthase (EC 4.2.1.24)
Porphobilinogen synthase (EC 4.2.1.24)
PF07992
*
Synechococcus sp. PCC 7002

Site:
position = -70
score = 6.37965
sequence = TTGATAATAATTATCATTTTTAT

Gene: SYNPCC7002_G0132: Predicted FAD-dependent oxidoreductase, PF07992 family
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -62
score = 6.37457
sequence = ATTAAAATGATAACCATTATTAT

Site:
position = -36
score = 6.12924
sequence = ATGAGAATGATTATCGTTAATTT

Gene: cce_4863: Predicted FAD-dependent oxidoreductase, PF07992 family
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: all4724: Predicted FAD-dependent oxidoreductase, PF07992 family
*
Trichodesmium erythraeum IMS101

Site:
position = -43
score = 6.51848
sequence = AAAAGAATGATAATCATTCTTAA

Gene: Tery_4613: Predicted FAD-dependent oxidoreductase, PF07992 family
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Predicted FAD-dependent oxidoreductase, PF07992 family
 
CRON 6.
glr0533
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
*
Gloeobacter violaceus PCC 7421

Site:
position = -40
score = 5.62945
sequence = TTGAGAACGACTATCATTGTTAT

Gene: glr0533: Predicted metal transporter
 
Thermosynechococcus elongatus BP-1
Predicted metal transporter
yciC2
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_D0010: Putative zinc chaperone, COG0523 family
 
Synechocystis sp. PCC 6803
*2
Cyanothece sp. ATCC 51142

Site:
position = -77
score = 6.11985
sequence = TTGAGAATGATTATTATTCTTAA

Site:
position = -38
score = 6.16874
sequence = ATGAAAATGATTATCATTTTAGA

Gene: cce_1488: Putative zinc chaperone, COG0523 family

Site:
position = -50
score = 5.77593
sequence = ATGAGATCAATTATCATTATCAT

Gene: cce_4857: Putative zinc chaperone, COG0523 family
*
Cyanothece sp. PCC 8801

Site:
position = -76
score = 5.37298
sequence = TTGAGAATGATTCTTATTCTTGA

Site:
position = -38
score = 5.74129
sequence = ATGAGAGTGATTATCATTCTAGA

Gene: PCC8801_0862: Putative zinc chaperone, COG0523 family
*
Cyanothece sp. PCC 7425

Site:
position = -41
score = 6.16639
sequence = TTGATAATGATTATCATTGTATA

Gene: Cyan7425_1909: Putative zinc chaperone, COG0523 family
 
Microcystis aeruginosa NIES-843
*
Nostoc sp. PCC 7120

Site:
position = -44
score = 5.01359
sequence = GTGATAATGATTATCCGTATGGT

Gene: all1751: Putative zinc chaperone, COG0523 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102

Gene: SYNW2482: Putative zinc chaperone, COG0523 family
 
Gloeobacter violaceus PCC 7421

Gene: glr0534: Putative zinc chaperone, COG0523 family
 
Thermosynechococcus elongatus BP-1
Putative zinc chaperone, COG0523 family
COG2319
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 2
Cyanothece sp. ATCC 51142

Gene: cce_1487: WD-40 repeat-containing protein, COG2319 family

Gene: cce_4858: WD-40 repeat-containing protein, COG2319 family
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0863: WD-40 repeat-containing protein, COG2319 family
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_1908: WD-40 repeat-containing protein, COG2319 family
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: all1750: WD-40 repeat-containing protein, COG2319 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102

Gene: SYNW2483: WD-40 repeat-containing protein, COG2319 family
 
Gloeobacter violaceus PCC 7421

Gene: glr0535: WD-40 repeat-containing protein, COG2319 family
 
Thermosynechococcus elongatus BP-1
WD-40 repeat-containing protein, COG2319 family
 
CRON 7.
znuA
*
Synechococcus sp. PCC 7002

Site:
position = -39
score = 5.54711
sequence = ATAAGAACGATTATCATTTCAAG

Gene: SYNPCC7002_A2501: Zinc ABC transporter, substrate-binding protein
*
Synechocystis sp. PCC 6803

Site:
position = -84
score = 5.6038
sequence = ATGATAATGATTATCGTTTATTG

Gene: slr2043: Zinc ABC transporter, substrate-binding protein
*2
Cyanothece sp. ATCC 51142

Site:
position = -72
score = 6.12924
sequence = AAATTAACGATAATCATTCTCAT

Site:
position = -46
score = 6.37457
sequence = ATAATAATGGTTATCATTTTAAT

Gene: cce_4862: Zinc ABC transporter, substrate-binding protein

Site:
position = -79
score = 5.59416
sequence = TTAATAGTGATAATGATTCTTAT

Gene: cce_2961: Zinc ABC transporter, substrate-binding protein
*
Cyanothece sp. PCC 8801

Site:
position = -52
score = 5.29102
sequence = GATACAATGATAATCGTTATCAG

Gene: PCC8801_3888: Zinc ABC transporter, substrate-binding protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_1915: Zinc ABC transporter, substrate-binding protein
*
Microcystis aeruginosa NIES-843

Site:
position = -67
score = 4.79342
sequence = TTCAGAATGATAACGATTCTCAC

Gene: MAE_20780: Zinc ABC transporter, substrate-binding pro
*
Nostoc sp. PCC 7120

Site:
position = -110
score = 6.15196
sequence = ATGAGAATGAGAATTATTATAAT

Site:
position = -80
score = 5.04367
sequence = TGTACAATAAGTATCATTGTCAA

Gene: all0833: Zinc ABC transporter, substrate-binding protein
*
Trichodesmium erythraeum IMS101

Site:
position = -49
score = 6.89596
sequence = AAAAGAATGATAATCATTATCAT

Gene: Tery_4951: Zinc ABC transporter, substrate-binding protein
*
Synechococcus elongatus PCC 7942

Site:
position = -84
score = 5.6038
sequence = ATGATAATGATTATCGTTTATTG

Gene: slr2043: Zinc ABC transporter, substrate-binding protein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2532: Zinc ABC transporter, substrate-binding protein
 
Synechococcus sp. WH 8102

Gene: SYNW2481: Zinc ABC transporter, substrate-binding protein
 
Gloeobacter violaceus PCC 7421
*
Thermosynechococcus elongatus BP-1

Site:
position = -31
score = 6.31155
sequence = ATGAGAATGATTATCATTCATCT

Gene: tlr2062: Zinc ABC transporter, substrate-binding protein
Zinc ABC transporter, substrate-binding protein
znuB
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A2500: Zinc ABC transporter, ATP-binding protein
 
Synechocystis sp. PCC 6803

Gene: slr2044: Zinc ABC transporter, ATP-binding protein
 2
Cyanothece sp. ATCC 51142

Gene: cce_4861: Zinc ABC transporter, ATP-binding protein

Gene: cce_2962: Zinc ABC transporter, ATP-binding protein
 
Cyanothece sp. PCC 8801

Gene: PCC8801_3889: Zinc ABC transporter, ATP-binding protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_1914: Zinc ABC transporter, ATP-binding protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_20770: Zinc ABC transporter, ATP-binding protein
 
Nostoc sp. PCC 7120

Gene: all0832: Zinc ABC transporter, ATP-binding protein
 
Trichodesmium erythraeum IMS101

Gene: Tery_4952: Zinc ABC transporter, ATP-binding protein
 
Synechococcus elongatus PCC 7942

Gene: slr2044: Zinc ABC transporter, ATP-binding protein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2531: Zinc ABC transporter, ATP-binding protein
 
Synechococcus sp. WH 8102

Gene: SYNW2480: Zinc ABC transporter, ATP-binding protein
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1

Gene: tlr2063: Zinc ABC transporter, ATP-binding protein
Zinc ABC transporter, ATP-binding protein
znuC
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A2499: Zinc ABC transporter, permease protein
 
Synechocystis sp. PCC 6803

Gene: slr2045: Zinc ABC transporter, permease protein
 2
Cyanothece sp. ATCC 51142

Gene: cce_4860: Zinc ABC transporter, permease protein

Gene: cce_2963: Zinc ABC transporter, permease protein
 
Cyanothece sp. PCC 8801

Gene: PCC8801_3890: Zinc ABC transporter, permease protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_1913: Zinc ABC transporter, permease protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_52810: Zinc ABC transporter, permease protein
 
Nostoc sp. PCC 7120

Gene: all0830: Zinc ABC transporter, permease protein
 
Trichodesmium erythraeum IMS101

Gene: Tery_4953: Zinc ABC transporter, permease protein
 
Synechococcus elongatus PCC 7942

Gene: slr2045: Zinc ABC transporter, permease protein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_2529: Zinc ABC transporter, permease protein
 
Synechococcus sp. WH 8102

Gene: SYNW2479: Zinc ABC transporter, permease protein
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1

Gene: tlr0501: Zinc ABC transporter, permease protein
Zinc ABC transporter, permease protein
zur
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A2498: Zinc uptake transcription regulator, Fur family
*
Synechocystis sp. PCC 6803

Site:
position = -45
score = 5.6038
sequence = CAATAAACGATAATCATTATCAT

Gene: sll1937: Zinc uptake transcription regulator, Fur family
*
Cyanothece sp. ATCC 51142

Site:
position = -120
score = 6.04887
sequence = ATAATAATGATTATTATTCTACA

Gene: cce_4859: Zinc uptake transcription regulator, Fur family
 
Cyanothece sp. PCC 8801

Gene: PCC8801_4134: Zinc uptake transcription regulator, Fur family
*
Cyanothece sp. PCC 7425

Site:
position = -56
score = 6.43243
sequence = ATGATAATGATTATCATTGCCTT

Gene: Cyan7425_1917: Zinc uptake transcription regulator, Fur family
 
Microcystis aeruginosa NIES-843

Gene: MAE_57540: Zinc uptake transcription regulator, Fur family
 
Nostoc sp. PCC 7120

Gene: all2473: Zinc uptake transcription regulator, Fur family
 
Trichodesmium erythraeum IMS101

Gene: Tery_1953: Zinc uptake transcription regulator, Fur family
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0817: Zinc uptake transcription regulator, Fur family
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT2208: Zinc uptake transcription regulator, Fur family
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1383: Zinc uptake transcription regulator, Fur family
 
Synechococcus sp. WH 8102

Gene: SYNW2401: Zinc uptake transcription regulator, Fur family
 
Gloeobacter violaceus PCC 7421

Gene: glr0783: Zinc uptake transcription regulator, Fur family
 
Thermosynechococcus elongatus BP-1

Gene: tlr0192: Zinc uptake transcription regulator, Fur family
Zinc uptake transcription regulator, Fur family
Cyan7425_1916
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
*
Cyanothece sp. PCC 7425

Site:
position = -104
score = 6.43243
sequence = AAGGCAATGATAATCATTATCAT

Gene: Cyan7425_1916: Hypothetical protein
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Hypothetical protein
sufE
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
*
Synechococcus sp. JA-3-3Ab

Site:
position = -39
score = 5.73875
sequence = TTATGATTGATTATCATTCTCAT

Gene: CYA_2533: Cysteine desulfuration protein
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Cysteine desulfuration protein
 
CRON 8.
alr3242
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
*
Nostoc sp. PCC 7120

Site:
position = -260
score = 4.28993
sequence = ATGATAATCATTATCAAAAAATG

Site:
position = -266
score = 5.56479
sequence = GTAAACATGATAATCATTATCAA

Gene: alr3242: Zinc-regulated TonB-dependent outer mambrane receptor
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Zinc-regulated TonB-dependent outer mambrane receptor
alr3243
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr3243: ABC transporter, periplasmic binding protein, COG0614 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
ABC transporter, periplasmic binding protein, COG0614 family
 
CRON 9.
alr1197
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -6
score = 4.69003
sequence = CTAACAATGATTACTGTAATTAT

Gene: cce_1494: Putative metallochaperone, similar to COG0523 family
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
*
Microcystis aeruginosa NIES-843

Site:
position = -6
score = 5.55075
sequence = GCTAGAATGATTATCATTATCAC

Gene: MAE_31630: Putative metallochaperone, similar to COG0523 family
*
Nostoc sp. PCC 7120

Site:
position = -29
score = 4.43984
sequence = AACTGCATGAAAATGATTATCAT

Site:
position = -23
score = 6.06488
sequence = ATGAAAATGATTATCATTTAAAA

Gene: alr1197: Putative metallochaperone, similar to COG0523 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Putative metallochaperone, similar to COG0523 family
alr1198
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142

Gene: cce_1493: Metallophosphoesterase, COG0622 family
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843

Gene: MAE_31640: Metallophosphoesterase, COG0622 family
 
Nostoc sp. PCC 7120

Gene: alr1198: Metallophosphoesterase, COG0622 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Metallophosphoesterase, COG0622 family
alr1199
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142

Gene: cce_1492: Metal-dependent phosphatase
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843

Gene: MAE_31650: Metal-dependent phosphatase
 
Nostoc sp. PCC 7120

Gene: alr1199: Metal-dependent phosphatase
*
Trichodesmium erythraeum IMS101

Site:
position = -84
score = 4.30461
sequence = TTTGAAACAAGTATTATTGTTTT

Gene: Tery_4609: Metal-dependent phosphatase
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Metal-dependent phosphatase
 
CRON 10.
omp
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
*2
Nostoc sp. PCC 7120

Site:
position = -122
score = 5.8542
sequence = GTGATAATAATAATCATTATCTA

Gene: alr4028: Zinc-regulated TonB-dependent outer mambrane receptor

Gene: alr4029: Zinc-regulated TonB-dependent outer mambrane receptor
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Zinc-regulated TonB-dependent outer mambrane receptor
alr4030
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr4030: Putative ferredoxin, COG3411 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Putative ferredoxin, COG3411 family
alr4031
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr4031: ABC transporter, periplasmic binding protein, COG0614 family
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
ABC transporter, periplasmic binding protein, COG0614 family
alr4032
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr4032: ABC transporter, permease protein
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
ABC transporter, permease protein
alr4033
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120

Gene: alr4033: ABC transporter, ATP-binding protein
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
ABC transporter, ATP-binding protein
 
CRON 11.
all3515
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
*
Nostoc sp. PCC 7120

Site:
position = -52
score = 5.42815
sequence = CTGATTATGATAATCATTATCGG

Gene: all3515: Putative outer membrane protein
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Putative outer membrane protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD