Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Synechococcus sp. PCC 7002
Synechocystis sp. PCC 6803 4 3
Cyanothece sp. ATCC 51142 5 2
Cyanothece sp. PCC 8801 5 2
Cyanothece sp. PCC 7425 5 2
Microcystis aeruginosa NIES-843 4 2
Nostoc sp. PCC 7120 5 2
Trichodesmium erythraeum IMS101 2 2
Synechococcus elongatus PCC 7942
Prochlorococcus marinus str. MIT 9313
Synechococcus sp. JA-3-3Ab
Synechococcus sp. WH 8102
Gloeobacter violaceus PCC 7421
Thermosynechococcus elongatus BP-1 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pncB
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A0508: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Synechocystis sp. PCC 6803
*
Cyanothece sp. ATCC 51142

Site:
position = -49
score = 5.90216
sequence = TTTTGGTAAAAGTTACTATAA

Gene: cce_2759: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Cyanothece sp. PCC 8801

Site:
position = -74
score = 6.04101
sequence = TTTTGGTAAAAACTACTATAA

Gene: PCC8801_0271: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Cyanothece sp. PCC 7425

Site:
position = -50
score = 6.08727
sequence = TTATGGTAGAAACTACTATAA

Gene: Cyan7425_2236: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Microcystis aeruginosa NIES-843
*
Nostoc sp. PCC 7120

Site:
position = -53
score = 6.42238
sequence = TTATGGTAAATTCTACCATAA

Gene: alr2482: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Trichodesmium erythraeum IMS101

Site:
position = -173
score = 5.85314
sequence = ATATAGTAAGAATAACTATAA

Gene: Tery_0318: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_1521: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
*
Thermosynechococcus elongatus BP-1

Site:
position = -48
score = 6.27305
sequence = TTATGGTGAAACTCACTATAA

Gene: tlr1177: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadD
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A0878: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Synechocystis sp. PCC 6803

Gene: sll1916: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Cyanothece sp. ATCC 51142

Gene: cce_2758: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0270: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2237: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
*
Microcystis aeruginosa NIES-843

Site:
position = -94
score = 5.92166
sequence = TTTTGGTAAAATCAACTATAA

Gene: MAE_34940: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Nostoc sp. PCC 7120

Gene: alr2483: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Trichodesmium erythraeum IMS101

Gene: Tery_0319: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0106: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1460: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_0491: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Synechococcus sp. WH 8102

Gene: SYNW0503: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Gloeobacter violaceus PCC 7421

Gene: glr4016: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Thermosynechococcus elongatus BP-1

Gene: tlr1178: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
nrtR
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803

Gene: slr1690: Nudix-related transcriptional regulator NrtR
 
Cyanothece sp. ATCC 51142

Gene: cce_2757: Nudix-related transcriptional regulator NrtR
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0269: Nudix-related transcriptional regulator NrtR
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2238: Nudix-related transcriptional regulator NrtR
 
Microcystis aeruginosa NIES-843

Gene: MAE_34930: Nudix-related transcriptional regulator NrtR
 
Nostoc sp. PCC 7120

Gene: alr2484: Nudix-related transcriptional regulator NrtR
 
Trichodesmium erythraeum IMS101

Gene: Tery_0320: Nudix-related transcriptional regulator NrtR
 
Synechococcus elongatus PCC 7942
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1

Gene: tlr1179: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
nadE
 
Synechococcus sp. PCC 7002
*
Synechocystis sp. PCC 6803

Site:
position = -34
score = 6.03305
sequence = TTAAAGTAATAATTACCATAA

Gene: slr1691: NAD synthetase (EC 6.3.1.5)
 
Cyanothece sp. ATCC 51142

Gene: cce_2756: NAD synthetase (EC 6.3.1.5)
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0268: NAD synthetase (EC 6.3.1.5)
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_2239: NAD synthetase (EC 6.3.1.5)
 
Microcystis aeruginosa NIES-843

Gene: MAE_34920: NAD synthetase (EC 6.3.1.5)
 
Nostoc sp. PCC 7120

Gene: alr2485: NAD synthetase (EC 6.3.1.5)
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0105: NAD synthetase (EC 6.3.1.5)
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT1461: NAD synthetase (EC 6.3.1.5)
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102

Gene: SYNW0502: NAD synthetase (EC 6.3.1.5)
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1

Gene: tlr1180: NAD synthetase (EC 6.3.1.5)
NAD synthetase (EC 6.3.1.5)
 
CRON 2.
nadA
 
Synechococcus sp. PCC 7002

Gene: SYNPCC7002_A1968: Quinolinate synthetase (EC 4.1.99.-)
*
Synechocystis sp. PCC 6803

Site:
position = -43
score = 6.09871
sequence = TTATGGTAGTTTTAACTATAA

Gene: sll0622: Quinolinate synthetase (EC 4.1.99.-)
*
Cyanothece sp. ATCC 51142

Site:
position = -24
score = 5.80744
sequence = TTTTGGTAAGATCAACTATAA

Gene: cce_3716: Quinolinate synthetase (EC 4.1.99.-)
*
Cyanothece sp. PCC 8801

Site:
position = -44
score = 6.09871
sequence = TTATGGTAAAAACAACTATAA

Gene: PCC8801_0787: Quinolinate synthetase (EC 4.1.99.-)
*
Cyanothece sp. PCC 7425

Site:
position = -53
score = 5.65774
sequence = TTTTGGTAAATTCGACTATAA

Gene: Cyan7425_4975: Quinolinate synthetase (EC 4.1.99.-)
*
Microcystis aeruginosa NIES-843

Site:
position = -29
score = 5.7562
sequence = ATTTGGTAAAAATAACCATAA

Gene: MAE_32960: Quinolinate synthetase (EC 4.1.99.-)
*
Nostoc sp. PCC 7120

Site:
position = -64
score = 6.04101
sequence = TTTTGGTAAAAACTACTATAA

Gene: all4673: Quinolinate synthetase (EC 4.1.99.-)
*
Trichodesmium erythraeum IMS101

Site:
position = -85
score = 4.62463
sequence = TTATAGTATAATTCATCAAAC

Gene: Tery_2446: Quinolinate synthetase (EC 4.1.99.-)
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_1448: Quinolinate synthetase (EC 4.1.99.-)
 
Prochlorococcus marinus str. MIT 9313

Gene: PMT0661: Quinolinate synthetase (EC 4.1.99.-)
 
Synechococcus sp. JA-3-3Ab

Gene: CYA_0946: Quinolinate synthetase (EC 4.1.99.-)
 
Synechococcus sp. WH 8102

Gene: SYNW1316: Quinolinate synthetase (EC 4.1.99.-)
 
Gloeobacter violaceus PCC 7421

Gene: gvip016: Quinolinate synthetase (EC 4.1.99.-)
*
Thermosynechococcus elongatus BP-1

Site:
position = -67
score = 5.78854
sequence = TTTTGGTAAAAGTCACTATAA

Gene: null: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
 
CRON 3.
nadM
 
Synechococcus sp. PCC 7002
*
Synechocystis sp. PCC 6803

Site:
position = -69
score = 6.01594
sequence = TTTTGGTGAAATCTACTATAA

Gene: slr0787: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0205: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421

Gene: glr1660: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Thermosynechococcus elongatus BP-1
Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
nadV
 
Synechococcus sp. PCC 7002
 
Synechocystis sp. PCC 6803

Gene: slr0788: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 8801
 
Cyanothece sp. PCC 7425
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Trichodesmium erythraeum IMS101
 
Synechococcus elongatus PCC 7942

Gene: Synpcc7942_0206: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. WH 8102
 
Gloeobacter violaceus PCC 7421
 
Thermosynechococcus elongatus BP-1
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD