Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 6 1
Salmonella typhimurium LT2 6 1
Citrobacter koseri ATCC BAA-895 6 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 6 1
Enterobacter sp. 638 6 1
Erwinia amylovora ATCC 49946 6 1
Yersinia pestis KIM
Serratia proteamaculans 568 6 1
Erwinia carotovora subsp. atroseptica SCRI1043 6 1
Edwardsiella tarda EIB202 6 1
Proteus mirabilis HI4320 6 1
Photorhabdus luminescens subsp. laumondii TTO1 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -31
score = 7.00269
sequence = TCAGCGAAACGTTTCGCTGA

Gene: b3748: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Salmonella typhimurium LT2

Site:
position = -32
score = 7.1264
sequence = CCAGCGAAACGTTTCGCTAG

Site:
position = -111
score = 6.21851
sequence = CTAGCGAAACGTTTCGACGG

Gene: STM3881: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -155
score = 7.1264
sequence = CCAGCGAAACGTTTCGCTAG

Gene: CKO_00088: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -116
score = 6.21851
sequence = CTCGCGAAACGTTTCGATGG

Site:
position = -38
score = 7.06324
sequence = TTAGCGAAACGTTTCGCTAG

Gene: KPN_04153: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Enterobacter sp. 638

Site:
position = -32
score = 7.1264
sequence = TCAGCGAAACGTTTCGCTAG

Gene: Ent638_4116: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Erwinia amylovora ATCC 49946

Site:
position = -108
score = 6.48647
sequence = CCAGCAAAACGTTTCGATGG

Site:
position = -30
score = 6.06562
sequence = CTGGCGAAACGTTTCGCTGT

Gene: EAM_0015: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -117
score = 6.79209
sequence = CCAGCGAAACGTTTCGATAG

Site:
position = -37
score = 6.90313
sequence = CAAGCGAAACGTTTCGCTGG

Gene: Spro_4901: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -32
score = 7.09193
sequence = TTAGCGAAACGTTTCGCTGG

Site:
position = -109
score = 6.75762
sequence = TTAGCGAAACGTTTCGATGG

Gene: ECA0010: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Edwardsiella tarda EIB202

Site:
position = -31
score = 7.04876
sequence = ATAGCGAAACGTTTCGCTGG

Gene: ETAE_3516: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Proteus mirabilis HI4320

Site:
position = -30
score = 6.95951
sequence = ACAGCGAAACGTTTCGCTGA

Gene: PMI0093: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -32
score = 6.86767
sequence = ATAGCGAAACGTTTCGCTAA

Site:
position = -110
score = 6.18982
sequence = TTATCGAAACGTTTCGATAG

Gene: plu0055: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3749: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Salmonella typhimurium LT2

Gene: STM3882: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00089: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04154: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Enterobacter sp. 638

Gene: Ent638_4115: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0016: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4900: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0011: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_3515: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Proteus mirabilis HI4320

Gene: PMI0092: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0056: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3750: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Salmonella typhimurium LT2

Gene: STM3883: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00090: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04155: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Enterobacter sp. 638

Gene: Ent638_4114: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0017: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4899: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0012: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_3514: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Proteus mirabilis HI4320

Gene: PMI0091: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0057: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3751: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Salmonella typhimurium LT2

Gene: STM3884: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00091: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04156: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Enterobacter sp. 638

Gene: Ent638_4113: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0018: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4898: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0013: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_3513: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Proteus mirabilis HI4320

Gene: PMI0090: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0058: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3752: Ribokinase (EC 2.7.1.15)
 
Salmonella typhimurium LT2

Gene: STM3885: Ribokinase (EC 2.7.1.15)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00092: Ribokinase (EC 2.7.1.15)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04157: Ribokinase (EC 2.7.1.15)
 
Enterobacter sp. 638

Gene: Ent638_4112: Ribokinase (EC 2.7.1.15)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0019: Ribokinase (EC 2.7.1.15)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4897: Ribokinase (EC 2.7.1.15)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0014: Ribokinase (EC 2.7.1.15)
 
Edwardsiella tarda EIB202

Gene: ETAE_3512: Ribokinase (EC 2.7.1.15)
 
Proteus mirabilis HI4320

Gene: PMI0089: Ribokinase (EC 2.7.1.15)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0059: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3753: Transcriptional repressor of ribose utilization, LacI family
 
Salmonella typhimurium LT2

Gene: STM3886: Transcriptional repressor of ribose utilization, LacI family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00093: Transcriptional repressor of ribose utilization, LacI family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04158: Transcriptional repressor of ribose utilization, LacI family
 
Enterobacter sp. 638

Gene: Ent638_4111: Transcriptional repressor of ribose utilization, LacI family
 
Erwinia amylovora ATCC 49946

Gene: EAM_0020: Transcriptional repressor of ribose utilization, LacI family
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4896: Transcriptional repressor of ribose utilization, LacI family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0015: Transcriptional repressor of ribose utilization, LacI family
 
Edwardsiella tarda EIB202

Gene: ETAE_3511: Transcriptional repressor of ribose utilization, LacI family
 
Proteus mirabilis HI4320

Gene: PMI0088: Transcriptional repressor of ribose utilization, LacI family
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0060: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD