Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 55 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 27 5
Salmonella typhimurium LT2 29 6
Citrobacter koseri ATCC BAA-895 13 6
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 16 6
Enterobacter sp. 638 14 5
Erwinia amylovora ATCC 49946 8 2
Yersinia pestis KIM 6 3
Serratia proteamaculans 568 18 5
Erwinia carotovora subsp. atroseptica SCRI1043 14 5
Edwardsiella tarda EIB202 18 5
Proteus mirabilis HI4320 10 3
Photorhabdus luminescens subsp. laumondii TTO1 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -43
score = 6.2149
sequence = CGTTATATTGTCGCCTACATAACG

Gene: b0763: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Salmonella typhimurium LT2

Site:
position = -44
score = 6.60289
sequence = CGTTATATTATCGTTTACATAACG

Gene: STM0781: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -43
score = 6.28306
sequence = CGCTATATTTGCGCCTACATAACG

Gene: CKO_02372: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -42
score = 6.62199
sequence = CGTTATATTATCGACTACATAACG

Gene: KPN_00777: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Enterobacter sp. 638

Site:
position = -43
score = 6.55593
sequence = CGTTATATTTATTTGTATATAACG

Gene: Ent638_1254: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Erwinia amylovora ATCC 49946

Site:
position = -44
score = 6.03244
sequence = CGTTATATCATCATATATATAGCG

Gene: EAM_1202: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Yersinia pestis KIM

Site:
position = -35
score = 5.95906
sequence = CGCTATATTCCTCCGTATATAACG

Gene: y3037: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Serratia proteamaculans 568

Site:
position = -60
score = 6.71449
sequence = CGTTATATTATTTTTTATATAACG

Gene: Spro_1303: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -44
score = 6.36131
sequence = CGTTATATTATTATTTACACAACG

Gene: ECA1393: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Edwardsiella tarda EIB202

Site:
position = -48
score = 6.27967
sequence = CGCCATATAATCGATTATACAACG

Gene: ETAE_2559: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Proteus mirabilis HI4320

Site:
position = -108
score = 5.98687
sequence = CGCTATATTTATTGATATATAACC

Site:
position = -55
score = 5.58148
sequence = CGTTATATCTTGATATATACAGCG

Gene: PMI0597: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1476: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0764: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Salmonella typhimurium LT2

Gene: STM0782: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02371: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00778: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Enterobacter sp. 638

Gene: Ent638_1255: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1203: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Yersinia pestis KIM

Gene: y3036: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Serratia proteamaculans 568

Gene: Spro_1304: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1394: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_2558: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Proteus mirabilis HI4320

Gene: PMI0598: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1477: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0765: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Salmonella typhimurium LT2

Gene: STM0783: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02370: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00779: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Enterobacter sp. 638

Gene: Ent638_1256: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1204: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Yersinia pestis KIM

Gene: y3035: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Serratia proteamaculans 568

Gene: Spro_1305: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1395: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_2557: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Proteus mirabilis HI4320

Gene: PMI0599: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1478: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
CRON 2.
ECA3096
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -41
score = 6.56099
sequence = CGTTATATAATTATTTATATATCG

Gene: STM3142: putative ABC-transporter periplasmic-binding component
*
Citrobacter koseri ATCC BAA-895

Site:
position = -42
score = 6.03144
sequence = CGTTGTATACTAATATATATATCG

Gene: CKO_04383: putative ABC-transporter periplasmic-binding component
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -50
score = 6.27616
sequence = CGTTATATAATTTAATACACAACG

Gene: KPN_02124: putative ABC-transporter periplasmic-binding component
*
Enterobacter sp. 638

Site:
position = -39
score = 6.08471
sequence = CGTTATATAATAATTTTCATAACG

Gene: Ent638_3396: putative ABC-transporter periplasmic-binding component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -44
score = 6.5001
sequence = CGCTATATTATTTTGTATATAACG

Gene: Spro_1372: putative ABC-transporter periplasmic-binding component
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -41
score = 6.33925
sequence = CGCTGTATTATTTTATATATAACG

Gene: ECA3096: putative ABC-transporter periplasmic-binding component
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative ABC-transporter periplasmic-binding component
ECA3095
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02125: putative ABC transporter, permease protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1373: putative ABC transporter, permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3095: putative ABC transporter, permease protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative ABC transporter, permease protein
ECA3094
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02126: putative ABC transporter, ATP-binding protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1374: putative ABC transporter, ATP-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3094: putative ABC transporter, ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative ABC transporter, ATP-binding protein
ECA3093
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM3141: putative ABC-transporter, molybdenum-binding periplasmic protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04382: putative ABC-transporter, molybdenum-binding periplasmic protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -31
score = 5.39241
sequence = CGCTATATTATCCGGTTTATAGCG

Gene: KPN_02127: putative ABC-transporter, molybdenum-binding periplasmic protein
 
Enterobacter sp. 638

Gene: Ent638_3395: putative ABC-transporter, molybdenum-binding periplasmic protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1375: putative ABC-transporter, molybdenum-binding periplasmic protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3093: putative ABC-transporter, molybdenum-binding periplasmic protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative ABC-transporter, molybdenum-binding periplasmic protein
 
CRON 3.
napF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -221
score = 5.74115
sequence = CGCTATATAAATATATTTATAACC

Gene: b2208: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
*
Salmonella typhimurium LT2

Site:
position = -225
score = 6.26451
sequence = CGTTATATAAATATCTATATAACT

Gene: STM2261: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -282
score = 5.13042
sequence = CGTTATATATATTAAGTGATAACG

Gene: y1442: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
*
Serratia proteamaculans 568

Site:
position = -422
score = 6.05929
sequence = CGCTGTATAATCAACTAGATAGCG

Gene: Spro_3488: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1898: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
*
Edwardsiella tarda EIB202

Site:
position = -246
score = 5.95823
sequence = CGCTGTATATTTAAGTAAATAGCG

Gene: ETAE_1114: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
napD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2207: NapD family protein
 
Salmonella typhimurium LT2

Gene: STM2260: NapD family protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00568: NapD family protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1443: NapD family protein
 
Serratia proteamaculans 568

Gene: Spro_3487: NapD family protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1897: NapD family protein
 
Edwardsiella tarda EIB202

Gene: ETAE_1115: NapD family protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
NapD family protein
napA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2206: nitrate reductase, periplasmic, large subunit
 
Salmonella typhimurium LT2

Gene: STM2259: nitrate reductase, periplasmic, large subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00569: nitrate reductase, periplasmic, large subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3486: nitrate reductase, periplasmic, large subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1896: nitrate reductase, periplasmic, large subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_1116: nitrate reductase, periplasmic, large subunit
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nitrate reductase, periplasmic, large subunit
napG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2205: quinol dehydrogenase periplasmic component
 
Salmonella typhimurium LT2

Gene: STM2258: quinol dehydrogenase periplasmic component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00570: quinol dehydrogenase periplasmic component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1895: quinol dehydrogenase periplasmic component
 
Edwardsiella tarda EIB202

Gene: ETAE_1117: quinol dehydrogenase periplasmic component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
quinol dehydrogenase periplasmic component
napH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2204: quinol dehydrogenase membrane component
 
Salmonella typhimurium LT2

Gene: STM2257: quinol dehydrogenase membrane component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00571: quinol dehydrogenase membrane component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1894: quinol dehydrogenase membrane component
 
Edwardsiella tarda EIB202

Gene: ETAE_1118: quinol dehydrogenase membrane component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
quinol dehydrogenase membrane component
napB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2203: cytochrome c-type protein
 
Salmonella typhimurium LT2

Gene: STM2256: cytochrome c-type protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00572: cytochrome c-type protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1446: cytochrome c-type protein
 
Serratia proteamaculans 568

Gene: Spro_3485: cytochrome c-type protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1893: cytochrome c-type protein
 
Edwardsiella tarda EIB202

Gene: ETAE_1119: cytochrome c-type protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
cytochrome c-type protein
napC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2202: nitrate reductase, cytochrome c-type, periplasmic
 
Salmonella typhimurium LT2

Gene: STM2255: nitrate reductase, cytochrome c-type, periplasmic
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00573: nitrate reductase, cytochrome c-type, periplasmic
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1447: nitrate reductase, cytochrome c-type, periplasmic
 
Serratia proteamaculans 568

Gene: Spro_3484: nitrate reductase, cytochrome c-type, periplasmic
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1892: nitrate reductase, cytochrome c-type, periplasmic
 
Edwardsiella tarda EIB202

Gene: ETAE_1120: nitrate reductase, cytochrome c-type, periplasmic
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
nitrate reductase, cytochrome c-type, periplasmic
ccmA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2201: ATP binding protein of heme exporter A
 
Salmonella typhimurium LT2

Gene: STM2254: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00574: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02081: ATP binding protein of heme exporter A
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2358: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Yersinia pestis KIM

Gene: y1567: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Serratia proteamaculans 568

Gene: Spro_3391: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1882: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2461: ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC superfamily (atp_bind), heme exporter protein, cytochrome c-type biogenesis protein
ccmB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2200: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Salmonella typhimurium LT2

Gene: STM2253: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00575: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02080: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2357: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Yersinia pestis KIM

Gene: y1568: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Serratia proteamaculans 568

Gene: Spro_3390: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1883: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Edwardsiella tarda EIB202

Gene: ETAE_2460: heme exporter protein B (cytochrome C-type biogenesis protein)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
heme exporter protein B (cytochrome C-type biogenesis protein)
ccmC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2199: heme exporter protein C
 
Salmonella typhimurium LT2

Gene: STM2252: heme exporter protein C
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00577: heme exporter protein C
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02079: heme exporter protein C
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2356: heme exporter protein C
 
Yersinia pestis KIM

Gene: y1569: heme exporter protein C
 
Serratia proteamaculans 568

Gene: Spro_3389: heme exporter protein C
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1884: heme exporter protein C
 
Edwardsiella tarda EIB202

Gene: ETAE_2459: heme exporter protein C
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
heme exporter protein C
ccmD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2198: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Salmonella typhimurium LT2

Gene: STM2251: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00578: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02078: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2355: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Yersinia pestis KIM

Gene: y1570: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Serratia proteamaculans 568

Gene: Spro_3388: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1885: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Edwardsiella tarda EIB202

Gene: ETAE_2458: heme exporter protein D (cytochrome C-type biogenesis protein)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
heme exporter protein D (cytochrome C-type biogenesis protein)
ccmE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2197: cytochrome C-type biogenesis protein
 
Salmonella typhimurium LT2

Gene: STM2250: cytochrome C-type biogenesis protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00579: cytochrome C-type biogenesis protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02077: cytochrome C-type biogenesis protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2354: cytochrome C-type biogenesis protein
 
Yersinia pestis KIM

Gene: y1571: cytochrome C-type biogenesis protein
 
Serratia proteamaculans 568

Gene: Spro_3387: cytochrome C-type biogenesis protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1886: cytochrome C-type biogenesis protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2457: cytochrome C-type biogenesis protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
cytochrome C-type biogenesis protein
ccmF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2196: heme lyase, CcmF subunit
 
Salmonella typhimurium LT2

Gene: STM2249: heme lyase, CcmF subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00581: heme lyase, CcmF subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02076: heme lyase, CcmF subunit
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2353: heme lyase, CcmF subunit
 
Yersinia pestis KIM

Gene: y1572: heme lyase, CcmF subunit
 
Serratia proteamaculans 568

Gene: Spro_3386: heme lyase, CcmF subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1887: heme lyase, CcmF subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_2456: heme lyase, CcmF subunit
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
heme lyase, CcmF subunit
ccmG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2195: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Salmonella typhimurium LT2

Gene: STM2248: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00582: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02075: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2352: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Yersinia pestis KIM

Gene: y1573: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Serratia proteamaculans 568

Gene: Spro_3385: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1888: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Edwardsiella tarda EIB202

Gene: ETAE_2455: periplasmic thioredoxin of cytochrome c-type biogenesis
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
periplasmic thioredoxin of cytochrome c-type biogenesis
ccmH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2194: cytochrome C biogenesis protein
 
Salmonella typhimurium LT2

Gene: STM2247: cytochrome C biogenesis protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00583: cytochrome C biogenesis protein
 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02074: cytochrome C biogenesis protein

Gene: KPN_02073: cytochrome C biogenesis protein
 
Enterobacter sp. 638
 2
Erwinia amylovora ATCC 49946

Gene: EAM_2351: cytochrome C biogenesis protein

Gene: EAM_2350: cytochrome C biogenesis protein
 2
Yersinia pestis KIM

Gene: y1574: cytochrome C biogenesis protein

Gene: y1575: cytochrome C biogenesis protein
 2
Serratia proteamaculans 568

Gene: Spro_3383: cytochrome C biogenesis protein

Gene: Spro_3384: cytochrome C biogenesis protein
 2
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1889: cytochrome C biogenesis protein

Gene: ECA1890: cytochrome C biogenesis protein
 2
Edwardsiella tarda EIB202

Gene: ETAE_2453: cytochrome C biogenesis protein

Gene: ETAE_2454: cytochrome C biogenesis protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
cytochrome C biogenesis protein
 
CRON 4.
dmsA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -97
score = 6.22939
sequence = CGATGTATACAAGCCTATATAGCG

Gene: b0894: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
*
Salmonella typhimurium LT2

Site:
position = -64
score = 6.27384
sequence = CGCTATATAAAATTCTATACATCG

Site:
position = -95
score = 5.86375
sequence = CGATATATATCAGACTTTATAGCG

Gene: STM0964: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -100
score = 6.32756
sequence = CATTATATACAAAACTATATAGCG

Site:
position = -69
score = 6.55264
sequence = CGTTGTATAAATAACTACATAACG

Gene: CKO_02177: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -61
score = 6.47845
sequence = CATTATATATATGTCTATATAACG

Gene: KPN_00926: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
*
Enterobacter sp. 638

Site:
position = -67
score = 6.44945
sequence = CTCTATATAAAAAACTATATAGCG

Gene: Ent638_1418: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0864: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 2
Edwardsiella tarda EIB202

Gene: ETAE_2194: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)

Gene: ETAE_2195: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
dmsB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0895: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Salmonella typhimurium LT2

Gene: STM0965: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00927: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Enterobacter sp. 638

Gene: Ent638_1419: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0865: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2193: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
dmsC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0896: Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
Salmonella typhimurium LT2

Gene: STM0966: Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00928: Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
Enterobacter sp. 638

Gene: Ent638_1420: Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0866: Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Anaerobic dimethyl sulfoxide reductase chain C (EC 1.8.99.-)
 
CRON 5.
moaA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -199
score = 6.78561
sequence = CGCTATATACATGATTACATAGCG

Gene: b0781: Molybdenum cofactor biosynthesis protein MoaA
*
Salmonella typhimurium LT2

Site:
position = -200
score = 6.60938
sequence = CGCTATGTATATGTTTATATAGCG

Gene: STM0802: Molybdenum cofactor biosynthesis protein MoaA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -189
score = 6.93297
sequence = CGCTATATACATGATTATATAGCG

Gene: CKO_02345: Molybdenum cofactor biosynthesis protein MoaA
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -193
score = 6.75989
sequence = CGATATATATAAGATTATATAGCG

Gene: KPN_00810: Molybdenum cofactor biosynthesis protein MoaA
*
Enterobacter sp. 638

Site:
position = -172
score = 6.12139
sequence = CGCTATGTATAGAATTATACAGCG

Gene: Ent638_1273: Molybdenum cofactor biosynthesis protein MoaA
*
Erwinia amylovora ATCC 49946

Site:
position = -211
score = 6.49793
sequence = CGCTATATATCAAAATATATAGCG

Gene: EAM_1218: Molybdenum cofactor biosynthesis protein MoaA
*
Yersinia pestis KIM

Site:
position = -242
score = 6.473
sequence = CGTTGTATATAATAATATATAGCG

Gene: y3023: Molybdenum cofactor biosynthesis protein MoaA
*
Serratia proteamaculans 568

Site:
position = -242
score = 6.62548
sequence = CGCTGTATACACAATTATATAGCG

Gene: Spro_1320: Molybdenum cofactor biosynthesis protein MoaA
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -256
score = 6.5089
sequence = CGCTATATATTATCTTATATATCG

Gene: ECA2817: Molybdenum cofactor biosynthesis protein MoaA
*
Edwardsiella tarda EIB202

Site:
position = -312
score = 6.92146
sequence = CGTTATATTTTTGATTATATAACG

Gene: ETAE_2347: Molybdenum cofactor biosynthesis protein MoaA
*
Proteus mirabilis HI4320

Site:
position = -241
score = 6.60369
sequence = CGTTGTATTATAAATTATATAACG

Gene: PMI0610: Molybdenum cofactor biosynthesis protein MoaA
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -234
score = 6.18533
sequence = AGGTATATATTCAATTATATAACG

Gene: plu1499: Molybdenum cofactor biosynthesis protein MoaA
Molybdenum cofactor biosynthesis protein MoaA
moaB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0782: Molybdenum cofactor biosynthesis protein MoaB
 
Salmonella typhimurium LT2

Gene: STM0803: Molybdenum cofactor biosynthesis protein MoaB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02344: Molybdenum cofactor biosynthesis protein MoaB
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00811: Molybdenum cofactor biosynthesis protein MoaB
 
Enterobacter sp. 638

Gene: Ent638_1274: Molybdenum cofactor biosynthesis protein MoaB
 
Erwinia amylovora ATCC 49946

Gene: EAM_1219: Molybdenum cofactor biosynthesis protein MoaB
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1321: Molybdenum cofactor biosynthesis protein MoaB
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2816: Molybdenum cofactor biosynthesis protein MoaB
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Molybdenum cofactor biosynthesis protein MoaB
moaC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0783: Molybdenum cofactor biosynthesis protein MoaC
 
Salmonella typhimurium LT2

Gene: STM0804: Molybdenum cofactor biosynthesis protein MoaC
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02343: Molybdenum cofactor biosynthesis protein MoaC
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00812: Molybdenum cofactor biosynthesis protein MoaC
 
Enterobacter sp. 638

Gene: Ent638_1275: Molybdenum cofactor biosynthesis protein MoaC
 
Erwinia amylovora ATCC 49946

Gene: EAM_1220: Molybdenum cofactor biosynthesis protein MoaC
 
Yersinia pestis KIM

Gene: y3021: Molybdenum cofactor biosynthesis protein MoaC
 
Serratia proteamaculans 568

Gene: Spro_1322: Molybdenum cofactor biosynthesis protein MoaC
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2815: Molybdenum cofactor biosynthesis protein MoaC
 
Edwardsiella tarda EIB202

Gene: ETAE_2346: Molybdenum cofactor biosynthesis protein MoaC
 
Proteus mirabilis HI4320

Gene: PMI0611: Molybdenum cofactor biosynthesis protein MoaC
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1500: Molybdenum cofactor biosynthesis protein MoaC
Molybdenum cofactor biosynthesis protein MoaC
moaD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0784: Molybdenum cofactor biosynthesis protein MoaD
 
Salmonella typhimurium LT2

Gene: STM0805: Molybdenum cofactor biosynthesis protein MoaD
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02342: Molybdenum cofactor biosynthesis protein MoaD
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00813: Molybdenum cofactor biosynthesis protein MoaD
 
Enterobacter sp. 638

Gene: Ent638_1276: Molybdenum cofactor biosynthesis protein MoaD
 
Erwinia amylovora ATCC 49946

Gene: EAM_1221: Molybdenum cofactor biosynthesis protein MoaD
 
Yersinia pestis KIM

Gene: y3020: Molybdenum cofactor biosynthesis protein MoaD
 
Serratia proteamaculans 568

Gene: Spro_1323: Molybdenum cofactor biosynthesis protein MoaD
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2814: Molybdenum cofactor biosynthesis protein MoaD
 
Edwardsiella tarda EIB202

Gene: ETAE_2345: Molybdenum cofactor biosynthesis protein MoaD
 
Proteus mirabilis HI4320

Gene: PMI0612: Molybdenum cofactor biosynthesis protein MoaD
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1501: Molybdenum cofactor biosynthesis protein MoaD
Molybdenum cofactor biosynthesis protein MoaD
moaE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0785: Molybdenum cofactor biosynthesis protein MoaE
 
Salmonella typhimurium LT2

Gene: STM0806: Molybdenum cofactor biosynthesis protein MoaE
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02341: Molybdenum cofactor biosynthesis protein MoaE
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00814: Molybdenum cofactor biosynthesis protein MoaE
 
Enterobacter sp. 638

Gene: Ent638_1277: Molybdenum cofactor biosynthesis protein MoaE
 
Erwinia amylovora ATCC 49946

Gene: EAM_1222: Molybdenum cofactor biosynthesis protein MoaE
 
Yersinia pestis KIM

Gene: y3019: Molybdenum cofactor biosynthesis protein MoaE
 
Serratia proteamaculans 568

Gene: Spro_1324: Molybdenum cofactor biosynthesis protein MoaE
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2813: Molybdenum cofactor biosynthesis protein MoaE
 
Edwardsiella tarda EIB202

Gene: ETAE_2344: Molybdenum cofactor biosynthesis protein MoaE
 
Proteus mirabilis HI4320

Gene: PMI0613: Molybdenum cofactor biosynthesis protein MoaE
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1502: Molybdenum cofactor biosynthesis protein MoaE
Molybdenum cofactor biosynthesis protein MoaE
 
CRON 6.
yghW
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -37
score = 6.17435
sequence = CGCTATATATGACAATATATAGCG

Gene: b2998: hypothetical protein
*
Salmonella typhimurium LT2

Site:
position = -38
score = 6.8636
sequence = CGCTATATAATTTATTATATAGCG

Gene: STM3151: hypothetical protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -36
score = 6.53963
sequence = CGCTATATAATTTGTTATATAGCG

Gene: CKO_04392: hypothetical protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -38
score = 6.91343
sequence = CGCTATATAATTTATTATATAACG

Gene: KPN_03420: hypothetical protein
*
Enterobacter sp. 638

Site:
position = -39
score = 6.43967
sequence = CGCTGTATAATTTATTATATATCG

Gene: Ent638_3406: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -45
score = 6.77538
sequence = CGTTATATAATTATTTATATAGCG

Gene: Spro_3145: hypothetical protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -44
score = 6.60032
sequence = CGTTATATTATTTAATATATAACG

Gene: ECA0060: hypothetical protein
*
Edwardsiella tarda EIB202

Site:
position = -50
score = 6.31793
sequence = CGTTATATATTTAGGTATATAGCG

Gene: ETAE_0941: hypothetical protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 7.
omp_mod
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -37
score = 6.14749
sequence = CGTAATATAAATTTTTACATAACG

Gene: CKO_02385: predicted TonB dependent outer mebrane transporter for molybdenum
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -61
score = 6.32233
sequence = CGATATATAAAAAATTACATATCG

Gene: ECA3565: predicted TonB dependent outer mebrane transporter for molybdenum
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted TonB dependent outer mebrane transporter for molybdenum
 
CRON 8.
modA1
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -84
score = 6.09541
sequence = CGTAATATATTTATATATATAACG

Gene: ETAE_0924: ABC-type molybdate transport system, periplasmic component
*
Proteus mirabilis HI4320

Site:
position = -44
score = 6.5317
sequence = CATTATATAAAAAATTATATAACG

Gene: PMI1539: ABC-type molybdate transport system, periplasmic component
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC-type molybdate transport system, periplasmic component
modB1
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0925: molybdenum transport system permease protein, modB
 
Proteus mirabilis HI4320

Gene: PMI1538: molybdenum transport system permease protein, modB
 
Photorhabdus luminescens subsp. laumondii TTO1
molybdenum transport system permease protein, modB
modC1
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0926: ABC-type molybdate transport system, ATP-binding protein
 
Proteus mirabilis HI4320

Gene: PMI1537: ABC-type molybdate transport system, ATP-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC-type molybdate transport system, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD