Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LacI - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 3 1
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895 1 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 2 1
Enterobacter sp. 638 1 1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043 2 1
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lacZ
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -38
score = 7.41669
sequence = AATTGTGAGCGGATAACAATT

Gene: b0344: Beta-galactosidase (EC 3.2.1.23)
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -38
score = 6.99698
sequence = AATTGTGAGCGAATAACAAAC

Gene: CKO_02825: Beta-galactosidase (EC 3.2.1.23)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -37
score = 7.19071
sequence = AAATGTGAGCGGATAACAATT

Gene: KPN_pKPN3p05871: Beta-galactosidase (EC 3.2.1.23)
*
Enterobacter sp. 638

Site:
position = -29
score = 6.31904
sequence = AATTGTGAGCGCTTCGCAAAG

Gene: Ent638_0928: Beta-galactosidase (EC 3.2.1.23)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -73
score = 7.41669
sequence = AATTGTGAGCGGATAACAATT

Gene: ECA1490: Beta-galactosidase (EC 3.2.1.23)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Beta-galactosidase (EC 3.2.1.23)
lacY
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0343: Lactose permease, MFS family
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_pKPN3p05870: Lactose permease, MFS family
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1489: Lactose permease, MFS family
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Lactose permease, MFS family
lacA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0342: Galactoside O-acetyltransferase (EC 2.3.1.18)
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Galactoside O-acetyltransferase (EC 2.3.1.18)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD