Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IclR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Glyoxylate bypass
Effector: Pyruvate; Glyoxylate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 3 1
Salmonella typhimurium LT2 3 1
Citrobacter koseri ATCC BAA-895 3 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 1
Enterobacter sp. 638 3 1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM 3 1
Serratia proteamaculans 568 3 1
Erwinia carotovora subsp. atroseptica SCRI1043 3 1
Edwardsiella tarda EIB202
Proteus mirabilis HI4320 3 1
Photorhabdus luminescens subsp. laumondii TTO1 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
aceB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -125
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: b4014: malate synthase A
*
Salmonella typhimurium LT2

Site:
position = -125
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: STM4183: malate synthase A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -125
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: CKO_03906: malate synthase A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -117
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: KPN_04395: malate synthase A
*
Enterobacter sp. 638

Site:
position = -127
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: Ent638_0218: malate synthase A
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -147
score = 8.17439
sequence = AAAATGGAAATCGTTTTTGATTTT

Gene: y0015: malate synthase A
*
Serratia proteamaculans 568

Site:
position = -172
score = 8.09146
sequence = AAAATGGAAATGGTTTTTGATTTT

Gene: Spro_4503: malate synthase A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -132
score = 8.32743
sequence = AAAATGGAAATTGTTTTTGATTTT

Gene: ECA3991: malate synthase A
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -80
score = 7.61703
sequence = AAAATGGAATTCATTTTTGATTTT

Gene: PMI2764: malate synthase A
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -77
score = 7.89571
sequence = AAAATGGAAATCGTTTTTGATTTA

Gene: plu4396: malate synthase A
malate synthase A
aceA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4015: isocitrate lyase
 
Salmonella typhimurium LT2

Gene: STM4184: isocitrate lyase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03905: isocitrate lyase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04396: isocitrate lyase
 
Enterobacter sp. 638

Gene: Ent638_0219: isocitrate lyase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0016: isocitrate lyase
 
Serratia proteamaculans 568

Gene: Spro_4502: isocitrate lyase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3990: isocitrate lyase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2763: isocitrate lyase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4395: isocitrate lyase
isocitrate lyase
aceK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4016: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Salmonella typhimurium LT2

Gene: STM4185: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03904: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04397: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Enterobacter sp. 638

Gene: Ent638_0220: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0018: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Serratia proteamaculans 568

Gene: Spro_4501: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3989: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2762: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4394: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
bifunctional isocitrate dehydrogenase kinase/phosphatase protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD