Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BetI - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Glycine betaine synthesis
Effector: Choline
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 4 2
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895 4 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 4 2
Enterobacter sp. 638
Erwinia amylovora ATCC 49946 4 2
Yersinia pestis KIM
Serratia proteamaculans 568 4 2
Erwinia carotovora subsp. atroseptica SCRI1043 4 2
Edwardsiella tarda EIB202
Proteus mirabilis HI4320 4 2
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
betT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -82
score = 6.70263
sequence = TTGATTGGACGTTCAATATA

Gene: b0314: choline transporter of high affinity
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -236
score = 6.70263
sequence = TTGATTGGACGTTCAATATA

Gene: CKO_02581: choline transporter of high affinity
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -82
score = 6.70263
sequence = TTGATTGGACGTTCAATATA

Gene: KPN_00587: choline transporter of high affinity
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -243
score = 5.92959
sequence = TTAATTGAATGCGCAATCAA

Gene: EAM_P133: choline transporter of high affinity
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -308
score = 7.04257
sequence = TTGATTGAACGTTCAATAAA

Gene: Spro_1512: choline transporter of high affinity
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -274
score = 7.04257
sequence = TTGATTGAACGTTCAATAAA

Gene: ECA1743: choline transporter of high affinity
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -161
score = 6.51974
sequence = TTAATTGAACATTCAATCAA

Gene: PMI1462: choline transporter of high affinity
 
Photorhabdus luminescens subsp. laumondii TTO1
choline transporter of high affinity
 
CRON 2.
betI
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -66
score = 6.63306
sequence = TATATTGAACGTCCAATCAA

Gene: b0313: transcriptional regulator of glycine betaine synthesis
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -48
score = 6.63306
sequence = TATATTGAACGTCCAATCAA

Gene: CKO_02582: transcriptional regulator of glycine betaine synthesis
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -48
score = 6.63306
sequence = TATATTGAACGTCCAATCAA

Gene: KPN_00586: transcriptional regulator of glycine betaine synthesis
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -66
score = 6.90108
sequence = TTGATTGAACGTTCAATATA

Gene: EAM_1685: transcriptional regulator of glycine betaine synthesis
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -124
score = 7.01471
sequence = TTTATTGAACGTTCAATCAA

Gene: Spro_1513: transcriptional regulator of glycine betaine synthesis
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -103
score = 7.01471
sequence = TTTATTGAACGTTCAATCAA

Gene: ECA1744: transcriptional regulator of glycine betaine synthesis
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -68
score = 6.53265
sequence = TTGATTGAATGTTCAATTAA

Gene: PMI1461: transcriptional regulator of glycine betaine synthesis
 
Photorhabdus luminescens subsp. laumondii TTO1
transcriptional regulator of glycine betaine synthesis
betB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0312: betaine aldehyde dehydrogenase, NAD-dependent
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02583: betaine aldehyde dehydrogenase, NAD-dependent
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00585: betaine aldehyde dehydrogenase, NAD-dependent
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_1686: betaine aldehyde dehydrogenase, NAD-dependent
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1514: betaine aldehyde dehydrogenase, NAD-dependent
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1745: betaine aldehyde dehydrogenase, NAD-dependent
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1460: betaine aldehyde dehydrogenase, NAD-dependent
 
Photorhabdus luminescens subsp. laumondii TTO1
betaine aldehyde dehydrogenase, NAD-dependent
betA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0311: choline dehydrogenase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02584: choline dehydrogenase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00584: choline dehydrogenase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_1687: choline dehydrogenase
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1515: choline dehydrogenase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1746: choline dehydrogenase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1459: choline dehydrogenase
 
Photorhabdus luminescens subsp. laumondii TTO1
choline dehydrogenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD