Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 7 5
Salmonella typhimurium LT2 7 5
Citrobacter koseri ATCC BAA-895 26 11
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 9 5
Enterobacter sp. 638 9 5
Erwinia amylovora ATCC 49946 5 3
Yersinia pestis KIM 6 4
Serratia proteamaculans 568 20 9
Erwinia carotovora subsp. atroseptica SCRI1043 13 6
Edwardsiella tarda EIB202 4 3
Proteus mirabilis HI4320 9 5
Photorhabdus luminescens subsp. laumondii TTO1 5 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dksA2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -49
score = 6.16125
sequence = TTAATGTTATGTTATAACGTTTC

Gene: CKO_00932: DnaK suppressor protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -43
score = 6.4596
sequence = GATATGTTATAATATAACAATTA

Gene: Spro_1939: DnaK suppressor protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DnaK suppressor protein
yciA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00933: protein of unknown function DUF198
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -69
score = 5.82403
sequence = GATATGTTATAACATAACAAAAT

Gene: Spro_2628: protein of unknown function DUF198
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
protein of unknown function DUF198
can2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00934: carbonic anhydrase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2627: carbonic anhydrase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
carbonic anhydrase
yciC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00925: Putative zinc chaperone, COG0523 family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2626: Putative zinc chaperone, COG0523 family
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Putative zinc chaperone, COG0523 family
hisI2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -25
score = 5.61005
sequence = TTATTGTTACGTTATAACATAAC

Gene: CKO_00923: phosphoribosyl-AMP cyclohydrolase

Gene: CKO_00924: phosphoribosyl-AMP cyclohydrolase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
phosphoribosyl-AMP cyclohydrolase
 
CRON 2.
znuC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -49
score = 6.53237
sequence = GAAGTGTGATATTATAACATTTC

Gene: b1858: high-affinity zinc ABC transporter, ATP-binding protein
*
Salmonella typhimurium LT2

Site:
position = -49
score = 6.65424
sequence = GAAATGTGATATTATAACATTCT

Gene: STM1892.S: high-affinity zinc ABC transporter, ATP-binding protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -49
score = 6.65424
sequence = GAAATGTGATATTATAACATTCT

Gene: CKO_01105: high-affinity zinc ABC transporter, ATP-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -49
score = 6.35496
sequence = GTGATGTGATATTATAACATTCA

Gene: KPN_02373: high-affinity zinc ABC transporter, ATP-binding protein
*
Enterobacter sp. 638

Site:
position = -48
score = 6.19447
sequence = TGGATGTGATATTATAACATTCG

Gene: Ent638_2427: high-affinity zinc ABC transporter, ATP-binding protein
*
Erwinia amylovora ATCC 49946

Site:
position = -48
score = 6.0646
sequence = ATTTTGTGATATTATAACATTTG

Gene: EAM_2001: high-affinity zinc ABC transporter, ATP-binding protein
*
Yersinia pestis KIM

Site:
position = -47
score = 5.65265
sequence = AAAGCGTAATATTATAACATTCA

Gene: y2250: high-affinity zinc ABC transporter, ATP-binding protein
*
Serratia proteamaculans 568

Site:
position = -50
score = 5.81505
sequence = GAGGCGTGATATTATAACATTCG

Gene: Spro_2774: high-affinity zinc ABC transporter, ATP-binding protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -46
score = 6.4252
sequence = TGTTTGTTATATTATAACATTAC

Gene: ECA2485: high-affinity zinc ABC transporter, ATP-binding protein
*
Edwardsiella tarda EIB202

Site:
position = -72
score = 6.72066
sequence = GAAACGTTATATTATAACATTCC

Gene: ETAE_1442: high-affinity zinc ABC transporter, ATP-binding protein
*
Proteus mirabilis HI4320

Site:
position = -47
score = 6.73178
sequence = GAAATGTTATATTATAACGTTTC

Gene: PMI1151: high-affinity zinc ABC transporter, ATP-binding protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -48
score = 6.63204
sequence = GAATTGTTATATTATAACATCTC

Gene: plu2114: high-affinity zinc ABC transporter, ATP-binding protein
high-affinity zinc ABC transporter, ATP-binding protein
znuB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1859: high-affinity zinc ABC transporter, membrane component
 
Salmonella typhimurium LT2

Gene: STM1893: high-affinity zinc ABC transporter, membrane component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01104: high-affinity zinc ABC transporter, membrane component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02374: high-affinity zinc ABC transporter, membrane component
 
Enterobacter sp. 638

Gene: Ent638_2428: high-affinity zinc ABC transporter, membrane component
 
Erwinia amylovora ATCC 49946

Gene: EAM_2002: high-affinity zinc ABC transporter, membrane component
 
Yersinia pestis KIM

Gene: y2251: high-affinity zinc ABC transporter, membrane component
 
Serratia proteamaculans 568

Gene: Spro_2775: high-affinity zinc ABC transporter, membrane component
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2486: high-affinity zinc ABC transporter, membrane component
 
Edwardsiella tarda EIB202

Gene: ETAE_1441: high-affinity zinc ABC transporter, membrane component
 
Proteus mirabilis HI4320

Gene: PMI1150: high-affinity zinc ABC transporter, membrane component
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2113: high-affinity zinc ABC transporter, membrane component
high-affinity zinc ABC transporter, membrane component
 
CRON 3.
znuA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -52
score = 6.4917
sequence = GAAATGTTATAATATCACACTTC

Gene: b1857: high-affinity zinc ABC transporter, substrate-binding protein
*
Salmonella typhimurium LT2

Site:
position = -52
score = 6.55198
sequence = AGAATGTTATAATATCACATTTC

Gene: STM1891: high-affinity zinc ABC transporter, substrate-binding protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -37
score = 6.55198
sequence = AGAATGTTATAATATCACATTTC

Gene: CKO_01106: high-affinity zinc ABC transporter, substrate-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -100
score = 6.27209
sequence = TGAATGTTATAATATCACATCAC

Gene: KPN_02372: high-affinity zinc ABC transporter, substrate-binding protein
*
Enterobacter sp. 638

Site:
position = -52
score = 6.05256
sequence = CGAATGTTATAATATCACATCCA

Gene: Ent638_2426: high-affinity zinc ABC transporter, substrate-binding protein
*
Erwinia amylovora ATCC 49946

Site:
position = -52
score = 5.9459
sequence = CAAATGTTATAATATCACAAAAT

Gene: EAM_2000: high-affinity zinc ABC transporter, substrate-binding protein
*
Yersinia pestis KIM

Site:
position = -51
score = 5.62491
sequence = TGAATGTTATAATATTACGCTTT

Gene: y2249: high-affinity zinc ABC transporter, substrate-binding protein
*
Serratia proteamaculans 568

Site:
position = -51
score = 5.6748
sequence = CGAATGTTATAATATCACGCCTC

Gene: Spro_2773: high-affinity zinc ABC transporter, substrate-binding protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -53
score = 6.3122
sequence = GTAATGTTATAATATAACAAACA

Gene: ECA2484: high-affinity zinc ABC transporter, substrate-binding protein
*
Edwardsiella tarda EIB202

Site:
position = -50
score = 6.61406
sequence = GGAATGTTATAATATAACGTTTC

Gene: ETAE_1443: high-affinity zinc ABC transporter, substrate-binding protein
*
Proteus mirabilis HI4320

Site:
position = -50
score = 6.70671
sequence = GAAACGTTATAATATAACATTTC

Gene: PMI1152: high-affinity zinc ABC transporter, substrate-binding protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -51
score = 6.61626
sequence = GAGATGTTATAATATAACAATTC

Gene: plu2115: high-affinity zinc ABC transporter, substrate-binding protein
high-affinity zinc ABC transporter, substrate-binding protein
 
CRON 4.
rpmE2
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -34
score = 5.62892
sequence = TTATGGTTATGTTATAACATAAC

Gene: b0296: 50S ribosomal protein L31 paralog
*
Salmonella typhimurium LT2

Site:
position = -35
score = 5.84495
sequence = TTATTGTTATGTTATAACATAAT

Gene: STM0469: 50S ribosomal protein L31 paralog
*
Citrobacter koseri ATCC BAA-895

Site:
position = -35
score = 5.45919
sequence = TTATTGTTACGTTATAACATAAT

Gene: CKO_02696: 50S ribosomal protein L31 paralog
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -35
score = 5.54967
sequence = TTATTGTTATGTTATAACGTAAT

Gene: KPN_00435: 50S ribosomal protein L31 paralog
*
Enterobacter sp. 638

Site:
position = -37
score = 5.56672
sequence = CTTTTGTTATGTTATAACAAAAC

Gene: Ent638_0934: 50S ribosomal protein L31 paralog
*
Erwinia amylovora ATCC 49946

Site:
position = -36
score = 5.95811
sequence = TTTTGGTTATATTATAACATATC

Gene: EAM_1015: 50S ribosomal protein L31 paralog
*
Yersinia pestis KIM

Site:
position = -36
score = 5.85423
sequence = ATGATGTTACATTATAACATACT

Gene: y1048: 50S ribosomal protein L31 paralog
*
Serratia proteamaculans 568

Site:
position = -36
score = 6.22245
sequence = TTATTGTTATAGTATAACATTAC

Gene: Spro_1125: 50S ribosomal protein L31 paralog
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -31
score = 6.04505
sequence = GATATGTTATAACATAACAATTG

Gene: ECA1168: 50S ribosomal protein L31 paralog
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -38
score = 6.5472
sequence = ATATTGTTATATTATAACATTAC

Gene: PMI3379: 50S ribosomal protein L31 paralog
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -32
score = 6.19613
sequence = GTAATGTTATATTATTACAATTT

Gene: plu0036: 50S ribosomal protein L31 paralog
50S ribosomal protein L31 paralog
rpmJ2
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4506: 50S ribosomal protein L36 paralog
 
Salmonella typhimurium LT2

Gene: STM0470: 50S ribosomal protein L36 paralog
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02695: 50S ribosomal protein L36 paralog
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00436: 50S ribosomal protein L36 paralog
 
Enterobacter sp. 638

Gene: Ent638_0935: 50S ribosomal protein L36 paralog
 
Erwinia amylovora ATCC 49946

Gene: EAM_1014: 50S ribosomal protein L36 paralog
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1124: 50S ribosomal protein L36 paralog
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1167: 50S ribosomal protein L36 paralog
*
Edwardsiella tarda EIB202

Site:
position = -148
score = 5.94284
sequence = GTATTGTTATAACATAACATATG

Gene: ETAE_1964: 50S ribosomal protein L36 paralog
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0035: 50S ribosomal protein L36 paralog
50S ribosomal protein L36 paralog
zinT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -56
score = 6.2532
sequence = TATATGTTACAATATAACATTAC

Gene: b1973: zinc-binding protein
*
Salmonella typhimurium LT2

Site:
position = -54
score = 6.24642
sequence = GCAATGTTATAATATAACAATCA

Gene: STM1263: zinc-binding protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -91
score = 6.7522
sequence = GTGATGTTATATTATAACATTCC

Gene: CKO_01827: zinc-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -55
score = 5.6982
sequence = GATATGTTATATCGTAACAATTT

Gene: KPN_04244: zinc-binding protein
*
Enterobacter sp. 638

Site:
position = -53
score = 6.11521
sequence = GATATGTTATACTATAACATCCT

Gene: Ent638_1993: zinc-binding protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3380: zinc-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1
zinc-binding protein
 
CRON 5.
znuC2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*2
Citrobacter koseri ATCC BAA-895

Site:
position = -141
score = 6.14003
sequence = TTATTGTTATGTTATAACATTTT

Gene: CKO_04054: putative zinc ABC transporter, ATP-binding protein

Site:
position = -45
score = 5.73455
sequence = CATTTGTTATGTTATAACGTTAC

Gene: CKO_00951: putative zinc ABC transporter, ATP-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -108
score = 6.00479
sequence = TTATTGTTATGTTATAACATTAA

Gene: KPN_03035: putative zinc ABC transporter, ATP-binding protein
*
Enterobacter sp. 638

Site:
position = -140
score = 5.92211
sequence = TTAGTGTTATGTTATAACATTAT

Gene: Ent638_3178: putative zinc ABC transporter, ATP-binding protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -185
score = 5.78697
sequence = GTGATGTTATAATGTAACACTTA

Gene: Spro_1121: putative zinc ABC transporter, ATP-binding protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -123
score = 6.4596
sequence = GATATGTTATAATATAACAATTA

Gene: ECA3756: putative zinc ABC transporter, ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative zinc ABC transporter, ATP-binding protein
znuB2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04053: putative zinc ABC transporter, membrane protein

Gene: CKO_00950: putative zinc ABC transporter, membrane protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03034: putative zinc ABC transporter, membrane protein
 
Enterobacter sp. 638

Gene: Ent638_3177: putative zinc ABC transporter, membrane protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1122: putative zinc ABC transporter, membrane protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3757: putative zinc ABC transporter, membrane protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative zinc ABC transporter, membrane protein
znuA2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04052: putative zinc ABC transporter, substrate-binding protein

Gene: CKO_00949: putative zinc ABC transporter, substrate-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03033: putative zinc ABC transporter, substrate-binding protein
 
Enterobacter sp. 638

Gene: Ent638_3176: putative zinc ABC transporter, substrate-binding protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1123: putative zinc ABC transporter, substrate-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3758: putative zinc ABC transporter, substrate-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative zinc ABC transporter, substrate-binding protein
 
CRON 6.
omr1
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -45
score = 6.28965
sequence = GATATGTTATGTTATAACATATC

Gene: CKO_00835: predicted zinc-related TonB-dependent outer membrane transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -85
score = 5.9958
sequence = TTATTGTTATGTTATAACATAAC

Site:
position = -80
score = 5.71076
sequence = GTTATGTTATAACATAACAAAAA

Gene: Spro_1297: predicted zinc-related TonB-dependent outer membrane transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related TonB-dependent outer membrane transporter
znuX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00834: predicted zinc-related ABC transporter, periplasmic binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1298: predicted zinc-related ABC transporter, periplasmic binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related ABC transporter, periplasmic binding protein
znuW
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00833: predicted zinc-related methyltransferase type 12
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1299: predicted zinc-related methyltransferase type 12
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related methyltransferase type 12
znuY
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00832: predicted zinc-related ABC transporter, permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1300: predicted zinc-related ABC transporter, permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related ABC transporter, permease protein
znuZ
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1301: predicted zinc-related ABC transporter, ATP-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related ABC transporter, ATP-binding protein
 
CRON 7.
pliG
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -53
score = 6.25168
sequence = GGATTGTTATATTATAACAGTTC

Gene: b1178: periplasmic lysozme inhibitor of g-type lysozyme
*
Salmonella typhimurium LT2

Site:
position = -54
score = 5.86998
sequence = TTATTGTTACAATATAACAATTA

Gene: STM2610: periplasmic lysozme inhibitor of g-type lysozyme
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
periplasmic lysozme inhibitor of g-type lysozyme
 
CRON 8.
ECA3248
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM2552: ABC-type uncharacterized transport system, periplasmic component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00246: ABC-type uncharacterized transport system, periplasmic component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02868: ABC-type uncharacterized transport system, periplasmic component
 
Enterobacter sp. 638

Gene: Ent638_3032: ABC-type uncharacterized transport system, periplasmic component
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = 6
score = 5.11145
sequence = TATGTGTTACATTATAACGGTTT

Gene: y1329: ABC-type uncharacterized transport system, periplasmic component
*
Serratia proteamaculans 568

Site:
position = -3
score = 5.26669
sequence = TTTATGTTACTTTATAACAATAA

Gene: Spro_3632: ABC-type uncharacterized transport system, periplasmic component
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -3
score = 5.67147
sequence = ATAATGTTACATTATAACGCTTT

Gene: ECA3248: ABC-type uncharacterized transport system, periplasmic component
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -42
score = 6.13711
sequence = GTGATGTTATATTATAACAAAAT

Gene: PMI1519: ABC-type uncharacterized transport system, periplasmic component
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC-type uncharacterized transport system, periplasmic component
ECA3247
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM2551: ABC-type uncharacterized transport system, permease component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00247: ABC-type uncharacterized transport system, permease component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02867: ABC-type uncharacterized transport system, permease component
 
Enterobacter sp. 638

Gene: Ent638_3031: ABC-type uncharacterized transport system, permease component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1330: ABC-type uncharacterized transport system, permease component
 
Serratia proteamaculans 568

Gene: Spro_3631: ABC-type uncharacterized transport system, permease component
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3247: ABC-type uncharacterized transport system, permease component
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1518: ABC-type uncharacterized transport system, permease component
 
Photorhabdus luminescens subsp. laumondii TTO1
ABC-type uncharacterized transport system, permease component
 
CRON 9.
ECA4254
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -29
score = 6.11899
sequence = TAATTGTTATGATATAACATATC

Gene: CKO_00850: predicted zinc-regulated ABC transporter, ATP-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -55
score = 5.37109
sequence = AATTTGGTATGTTATAACATACC

Gene: ECA4254: predicted zinc-regulated ABC transporter, ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-regulated ABC transporter, ATP-binding protein
ECA4255
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00851: predicted zinc-regulated ABC transporter, periplasmic-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4255: predicted zinc-regulated ABC transporter, periplasmic-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-regulated ABC transporter, periplasmic-binding protein
ECA4256
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00852: predicted zinc-regulated ABC transporter, permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4256: predicted zinc-regulated ABC transporter, permease protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-regulated ABC transporter, permease protein
 
CRON 10.
CKO_00947
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -111
score = 5.79897
sequence = GTTATGTTATTTTATAACATCCA

Gene: CKO_00947: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -47
score = 5.37908
sequence = GAGATGTTTTGTTATAACGTATC

Gene: Spro_3158: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 11.
omr2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -23
score = 5.77877
sequence = GATATGTTATAACATAACAAAAA

Gene: PMI2619: predicted zinc-related TonB-dependent outer membrane transporter
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related TonB-dependent outer membrane transporter
omr3
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2618: predicted zinc-related TonB-dependent outer membrane transporter
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted zinc-related TonB-dependent outer membrane transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD