Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PdhR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 17 6
Salmonella typhimurium LT2 12 5
Citrobacter koseri ATCC BAA-895 11 5
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 7 4
Enterobacter sp. 638 12 5
Erwinia amylovora ATCC 49946 4 1
Yersinia pestis KIM 7 4
Serratia proteamaculans 568 6 3
Erwinia carotovora subsp. atroseptica SCRI1043 5 2
Edwardsiella tarda EIB202 6 3
Proteus mirabilis HI4320 6 3
Photorhabdus luminescens subsp. laumondii TTO1 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cyoA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -230
score = 5.66584
sequence = CACATTGGTTATACCAATTGC

Gene: b0432: cytochrome o ubiquinol oxidase subunit II
*
Salmonella typhimurium LT2

Site:
position = -230
score = 5.62576
sequence = TACATTGGTTATACCAATTAT

Gene: STM0443: cytochrome o ubiquinol oxidase subunit II
*
Citrobacter koseri ATCC BAA-895

Site:
position = -230
score = 5.69906
sequence = TACATTGGTTATACCAATTAC

Gene: CKO_02729: cytochrome o ubiquinol oxidase subunit II
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00394: cytochrome o ubiquinol oxidase subunit II
*
Enterobacter sp. 638

Site:
position = -243
score = 5.13105
sequence = AGCAATGGTTATACCAATTGC

Gene: Ent638_0899: cytochrome o ubiquinol oxidase subunit II
 
Erwinia amylovora ATCC 49946

Gene: EAM_0985: cytochrome o ubiquinol oxidase subunit II
 
Yersinia pestis KIM

Gene: y1021: cytochrome o ubiquinol oxidase subunit II
 
Serratia proteamaculans 568

Gene: Spro_1090: cytochrome o ubiquinol oxidase subunit II
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1143: cytochrome o ubiquinol oxidase subunit II
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0108: cytochrome o ubiquinol oxidase subunit II
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3875: cytochrome o ubiquinol oxidase subunit II
cytochrome o ubiquinol oxidase subunit II
cyoB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0431: cytochrome o ubiquinol oxidase subunit I
 
Salmonella typhimurium LT2

Gene: STM0442: cytochrome o ubiquinol oxidase subunit I
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02730: cytochrome o ubiquinol oxidase subunit I
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00393: cytochrome o ubiquinol oxidase subunit I
 
Enterobacter sp. 638

Gene: Ent638_0898: cytochrome o ubiquinol oxidase subunit I
 
Erwinia amylovora ATCC 49946

Gene: EAM_0984: cytochrome o ubiquinol oxidase subunit I
 
Yersinia pestis KIM

Gene: y1020: cytochrome o ubiquinol oxidase subunit I
 
Serratia proteamaculans 568

Gene: Spro_1089: cytochrome o ubiquinol oxidase subunit I
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1142: cytochrome o ubiquinol oxidase subunit I
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0107: cytochrome o ubiquinol oxidase subunit I
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3876: cytochrome o ubiquinol oxidase subunit I
cytochrome o ubiquinol oxidase subunit I
cyoC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0430: cytochrome o ubiquinol oxidase subunit III
 
Salmonella typhimurium LT2

Gene: STM0441: cytochrome o ubiquinol oxidase subunit III
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02731: cytochrome o ubiquinol oxidase subunit III
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00392: cytochrome o ubiquinol oxidase subunit III
 
Enterobacter sp. 638

Gene: Ent638_0897: cytochrome o ubiquinol oxidase subunit III
 
Erwinia amylovora ATCC 49946

Gene: EAM_0983: cytochrome o ubiquinol oxidase subunit III
 
Yersinia pestis KIM

Gene: y1019: cytochrome o ubiquinol oxidase subunit III
 
Serratia proteamaculans 568

Gene: Spro_1088: cytochrome o ubiquinol oxidase subunit III
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1141: cytochrome o ubiquinol oxidase subunit III
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0106: cytochrome o ubiquinol oxidase subunit III
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3877: cytochrome o ubiquinol oxidase subunit III
cytochrome o ubiquinol oxidase subunit III
cyoD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0429: cytochrome o ubiquinol oxidase subunit IV
 
Salmonella typhimurium LT2

Gene: STM0440: cytochrome o ubiquinol oxidase subunit IV
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02732: cytochrome o ubiquinol oxidase subunit IV
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00391: cytochrome o ubiquinol oxidase subunit IV
 
Enterobacter sp. 638

Gene: Ent638_0896: cytochrome o ubiquinol oxidase subunit IV
 
Erwinia amylovora ATCC 49946

Gene: EAM_0982: cytochrome o ubiquinol oxidase subunit IV
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1087: cytochrome o ubiquinol oxidase subunit IV
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1140: cytochrome o ubiquinol oxidase subunit IV
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0105A: cytochrome o ubiquinol oxidase subunit IV
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3878: cytochrome o ubiquinol oxidase subunit IV
cytochrome o ubiquinol oxidase subunit IV
cyoE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0428: protoheme IX farnesyltransferase
 
Salmonella typhimurium LT2

Gene: STM0439: protoheme IX farnesyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02733: protoheme IX farnesyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00390: protoheme IX farnesyltransferase
 
Enterobacter sp. 638

Gene: Ent638_0895: protoheme IX farnesyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0981: protoheme IX farnesyltransferase
 
Yersinia pestis KIM

Gene: y1018: protoheme IX farnesyltransferase
 
Serratia proteamaculans 568

Gene: Spro_1086: protoheme IX farnesyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1139: protoheme IX farnesyltransferase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0105: protoheme IX farnesyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3879: protoheme IX farnesyltransferase
protoheme IX farnesyltransferase
 
CRON 2.
yfiD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -68
score = 5.65711
sequence = AACAATGGTTTTACCAATTGG

Gene: b2579: stress-induced alternate pyruvate formate-lyase subunit
*
Salmonella typhimurium LT2

Site:
position = -71
score = 5.65711
sequence = AACAATGGTTTTACCAATTGG

Gene: STM2646: stress-induced alternate pyruvate formate-lyase subunit
*
Citrobacter koseri ATCC BAA-895

Site:
position = -70
score = 5.65711
sequence = AACAATGGTTTTACCAATTGG

Gene: CKO_00205: stress-induced alternate pyruvate formate-lyase subunit
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -67
score = 5.65711
sequence = AACAATGGTTTTACCAATTGG

Gene: KPN_02902: stress-induced alternate pyruvate formate-lyase subunit
*
Enterobacter sp. 638

Site:
position = -67
score = 5.65711
sequence = AACAATGGTTTTACCAATTGG

Gene: Ent638_3064: stress-induced alternate pyruvate formate-lyase subunit
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -73
score = 6.04674
sequence = AACATTGGTTTTACCAAATAA

Gene: y1282: stress-induced alternate pyruvate formate-lyase subunit
*
Serratia proteamaculans 568

Site:
position = -82
score = 5.46644
sequence = AACAATGGTTTTACCAAATGG

Gene: Spro_3682: stress-induced alternate pyruvate formate-lyase subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3288: stress-induced alternate pyruvate formate-lyase subunit
*
Edwardsiella tarda EIB202

Site:
position = -89
score = 5.88779
sequence = AACATTGGTTTTACCAAATGG

Gene: ETAE_2732: stress-induced alternate pyruvate formate-lyase subunit
*
Proteus mirabilis HI4320

Site:
position = -75
score = 5.67473
sequence = AACATTGGTTAGACCAAATAC

Gene: PMI1898: stress-induced alternate pyruvate formate-lyase subunit
 
Photorhabdus luminescens subsp. laumondii TTO1
stress-induced alternate pyruvate formate-lyase subunit
 
CRON 3.
ndh
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -138
score = 6.3993
sequence = AATTTTGGTATGACCAATGCA

Gene: b1109: NADH dehydrogenase
*
Salmonella typhimurium LT2

Site:
position = -138
score = 6.3993
sequence = AATTTTGGTATGACCAATGCA

Gene: STM1211: NADH dehydrogenase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -151
score = 6.3993
sequence = AATTTTGGTATGACCAATGCA

Gene: CKO_01946: NADH dehydrogenase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -136
score = 6.3993
sequence = AATTTTGGTATGACCAATGCA

Gene: KPN_01106: NADH dehydrogenase
*
Enterobacter sp. 638

Site:
position = -137
score = 6.08099
sequence = AATTTTGGTATGACCAATGCG

Gene: Ent638_1624: NADH dehydrogenase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1473: NADH dehydrogenase
*
Yersinia pestis KIM

Site:
position = -136
score = 6.26475
sequence = AATTTTGGTATGACCATATGA

Gene: y1777: NADH dehydrogenase
*
Serratia proteamaculans 568

Site:
position = -137
score = 6.4465
sequence = AATTTTGGTATGACCAAATAA

Gene: Spro_1926: NADH dehydrogenase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -137
score = 6.4465
sequence = AATTTTGGTATGACCAAATAA

Gene: ECA1815: NADH dehydrogenase
*
Edwardsiella tarda EIB202

Site:
position = -150
score = 6.4465
sequence = AATTTTGGTATGACCAAATTA

Gene: ETAE_2070: NADH dehydrogenase
*
Proteus mirabilis HI4320

Site:
position = -141
score = 5.671
sequence = AACTTTGGTATGACCATATTG

Gene: PMI0875: NADH dehydrogenase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -138
score = 5.83258
sequence = AATTTTGGTATGACCCACTAA

Gene: plu2821: NADH dehydrogenase
NADH dehydrogenase
 
CRON 4.
pdhR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -50
score = 6.70577
sequence = GAAATTGGTAAGACCAATTGA

Gene: b0113: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Salmonella typhimurium LT2

Site:
position = -51
score = 6.70577
sequence = GAAATTGGTAAGACCAATTGA

Gene: STM0151: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -51
score = 6.70577
sequence = GAAATTGGTAAGACCAATTGA

Gene: CKO_03260: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -49
score = 6.65759
sequence = TAAATTGGTAAGACCAATTGA

Gene: KPN_00117: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Enterobacter sp. 638

Site:
position = -51
score = 6.70577
sequence = GAAATTGGTAAGACCAATTGA

Gene: Ent638_0659: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Erwinia amylovora ATCC 49946

Site:
position = -49
score = 6.55194
sequence = TAAATTGGTATTACCAATTTA

Gene: EAM_0746: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Yersinia pestis KIM

Site:
position = -70
score = 6.75948
sequence = GAAATTGGTATTACCAATTGA

Gene: y0766: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Serratia proteamaculans 568

Site:
position = -52
score = 6.75948
sequence = GAAATTGGTATTACCAATTGA

Gene: Spro_4012: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -51
score = 6.75948
sequence = GAAATTGGTATTACCAATTGA

Gene: ECA3790: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Edwardsiella tarda EIB202

Site:
position = -74
score = 6.49541
sequence = GAAATTGGTAATACCAATTTA

Gene: ETAE_0658: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Proteus mirabilis HI4320

Site:
position = -69
score = 6.7113
sequence = TAAATTGGTATTACCAATTGA

Gene: PMI2047: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -315
score = 6.7113
sequence = TAAATTGGTATTACCAATTGA

Gene: plu3624: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
aceE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0114: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Salmonella typhimurium LT2

Gene: STM0152: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03259: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00118: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Enterobacter sp. 638

Gene: Ent638_0660: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0747: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Yersinia pestis KIM

Gene: y0767: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Serratia proteamaculans 568

Gene: Spro_4011: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3789: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Edwardsiella tarda EIB202

Gene: ETAE_0659: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Proteus mirabilis HI4320

Gene: PMI2046: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3623: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
aceF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0115: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Salmonella typhimurium LT2

Gene: STM0153: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03258: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00119: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Enterobacter sp. 638

Gene: Ent638_0661: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0748: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Yersinia pestis KIM

Gene: y0768: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Serratia proteamaculans 568

Gene: Spro_4010: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3788: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Edwardsiella tarda EIB202

Gene: ETAE_0660: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Proteus mirabilis HI4320

Gene: PMI2045: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3622: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
lpdA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0116: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Salmonella typhimurium LT2

Gene: STM0154: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03256: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00120: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Enterobacter sp. 638

Gene: Ent638_0662: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0749: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Yersinia pestis KIM

Gene: y0769: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Serratia proteamaculans 568

Gene: Spro_4009: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3787: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Edwardsiella tarda EIB202

Gene: ETAE_0662: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Proteus mirabilis HI4320

Gene: PMI2044: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3621: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
CRON 5.
glcD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -238
score = 4.01435
sequence = TGCACAGGTAGGACCAATTTT

Site:
position = -121
score = 3.94205
sequence = AAAAATGGTCTGACCGGTAGC

Gene: b2979: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
glcE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4468: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
glcF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4467: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
glcG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2977: Hypothetical protein GlcG in glycolate utilization operon
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Hypothetical protein GlcG in glycolate utilization operon
glcB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2976: Malate synthase G (EC 2.3.3.9)
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Malate synthase G (EC 2.3.3.9)
 
CRON 6.
hemL
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -214
score = 3.69674
sequence = CTTATTGGTCATACAAATAAG

Gene: b0154: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
*
Salmonella typhimurium LT2

Site:
position = -159
score = 4.78324
sequence = TTAATTGGTAATACAAATCTA

Gene: STM0202: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -382
score = 4.78324
sequence = TTAATTGGTAATACAAATACA

Gene: CKO_03214: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -170
score = 5.16854
sequence = ATTATTGGTAATACAAATGAA

Gene: KPN_00169: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
*
Enterobacter sp. 638

Site:
position = -168
score = 3.80936
sequence = TATATTGATCATACAAATATT

Gene: Ent638_0694: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0809: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
*
Yersinia pestis KIM

Site:
position = -344
score = 3.77286
sequence = AAATTTGATGTAACCAGAGTC

Gene: y0799: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Serratia proteamaculans 568

Gene: Spro_0781: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3307: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Edwardsiella tarda EIB202

Gene: ETAE_2778: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Proteus mirabilis HI4320

Gene: PMI0205: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0902: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD