Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glucarate utilization; Galactarate utilization
Effector: Glycerate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 9 4
Salmonella typhimurium LT2 9 4
Citrobacter koseri ATCC BAA-895 9 4
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 10 4
Enterobacter sp. 638 10 4
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043 8 4
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
garD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -250
score = 4.50599
sequence = CATTGTGCAAATGCTAATTT

Site:
position = -208
score = 5.98822
sequence = TTTTGAGCATATGCACATAA

Gene: b3128: D-galactarate dehydratase (EC 4.2.1.42)
*
Salmonella typhimurium LT2

Site:
position = -276
score = 4.77058
sequence = CATTGTGCAAACGCTCATTA

Site:
position = -233
score = 5.12915
sequence = TTTTGAGCATACGCCCATGA

Gene: STM3250: D-galactarate dehydratase (EC 4.2.1.42)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -223
score = 5.5751
sequence = TTTTGAGCATTTGCACAACG

Gene: CKO_04527: D-galactarate dehydratase (EC 4.2.1.42)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -206
score = 4.69404
sequence = AATTGTGCTTATGCCATAAG

Gene: KPN_03540: D-galactarate dehydratase (EC 4.2.1.42)
*
Enterobacter sp. 638

Site:
position = -224
score = 5.37345
sequence = ATTTGAGCATATGCACAACC

Gene: Ent638_3570: D-galactarate dehydratase (EC 4.2.1.42)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -140
score = 4.15729
sequence = CTTAGGTCAATTGCATAATG

Site:
position = -316
score = 4.55689
sequence = GTTGGTGCACTTGCCCTATA

Gene: ECA3578: D-galactarate dehydratase (EC 4.2.1.42)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-galactarate dehydratase (EC 4.2.1.42)
 
CRON 2.
gudX
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2788: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Salmonella typhimurium LT2

Gene: STM2961: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04142: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03131: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Enterobacter sp. 638

Gene: Ent638_3241: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -358
score = 4.10233
sequence = TGCTGGGCTATTGCCCAATG

Gene: ECA3576: Glucarate dehydratase related protein (EC 4.2.1.-)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glucarate dehydratase related protein (EC 4.2.1.-)
gudD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2787: Glucarate dehydratase (EC 4.2.1.40)
 
Salmonella typhimurium LT2

Gene: STM2960: Glucarate dehydratase (EC 4.2.1.40)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04141: Glucarate dehydratase (EC 4.2.1.40)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03130: Glucarate dehydratase (EC 4.2.1.40)
 
Enterobacter sp. 638

Gene: Ent638_3240: Glucarate dehydratase (EC 4.2.1.40)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3575: Glucarate dehydratase (EC 4.2.1.40)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glucarate dehydratase (EC 4.2.1.40)
garL
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3126: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
*
Salmonella typhimurium LT2

Site:
position = -316
score = 5.12915
sequence = TCATGGGCGTATGCTCAAAA

Site:
position = -273
score = 4.77058
sequence = TAATGAGCGTTTGCACAATG

Gene: STM3249: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -203
score = 5.5751
sequence = CGTTGTGCAAATGCTCAAAA

Gene: CKO_04523: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03538: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
 
Enterobacter sp. 638

Gene: Ent638_3568: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3574: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
garR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3125: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Salmonella typhimurium LT2

Gene: STM3248: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04522: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03537: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Enterobacter sp. 638

Gene: Ent638_3567: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3573: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
garK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3124: Glycerate kinase (EC 2.7.1.31)
 2
Salmonella typhimurium LT2

Gene: STM3247: Glycerate kinase (EC 2.7.1.31)

Gene: STM2959: Glycerate kinase (EC 2.7.1.31)
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_04140: Glycerate kinase (EC 2.7.1.31)

Gene: CKO_04521: Glycerate kinase (EC 2.7.1.31)
 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03129: Glycerate kinase (EC 2.7.1.31)

Gene: KPN_03536: Glycerate kinase (EC 2.7.1.31)
 2
Enterobacter sp. 638

Gene: Ent638_3239: Glycerate kinase (EC 2.7.1.31)

Gene: Ent638_3566: Glycerate kinase (EC 2.7.1.31)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3572: Glycerate kinase (EC 2.7.1.31)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glycerate kinase (EC 2.7.1.31)
garP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -144
score = 4.50599
sequence = AAATTAGCATTTGCACAATG

Site:
position = -186
score = 5.98822
sequence = TTATGTGCATATGCTCAAAA

Gene: b3127: D-galactarate permease, MFS family
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -206
score = 4.69404
sequence = CTTATGGCATAAGCACAATT

Gene: KPN_03539: D-galactarate permease, MFS family
*
Enterobacter sp. 638

Site:
position = -208
score = 5.37345
sequence = GGTTGTGCATATGCTCAAAT

Gene: Ent638_3569: D-galactarate permease, MFS family
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-galactarate permease, MFS family
gudP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -385
score = 4.7362
sequence = TTTCAGGCAAATGCCAGTAA

Gene: b2789: D-glucarate permease, MFS family
*
Salmonella typhimurium LT2

Site:
position = -376
score = 5.52925
sequence = CTTTGTGCATATGCCCGCAA

Gene: STM2962: D-glucarate permease, MFS family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -388
score = 4.94857
sequence = CATCAGGCATTTGCCCTAAA

Gene: CKO_04143: D-glucarate permease, MFS family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -376
score = 4.38968
sequence = CTTTAGGCAAACGCCACAAT

Site:
position = -221
score = 4.5698
sequence = TTTCAGGCATTCGCCACAAA

Gene: KPN_03132: D-glucarate permease, MFS family
*
Enterobacter sp. 638

Site:
position = -240
score = 4.89438
sequence = CGTTGTGCTTATGCCTCAAA

Gene: Ent638_3242: D-glucarate permease, MFS family
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -440
score = 4.15729
sequence = CATTATGCAATTGACCTAAG

Site:
position = -264
score = 4.55689
sequence = TATAGGGCAAGTGCACCAAC

Gene: ECA3577: D-glucarate permease, MFS family
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-glucarate permease, MFS family
 
CRON 3.
sdaR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -69
score = 5.3349
sequence = CTTTAGGCATTTGCACAATG

Gene: b0162: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
*
Salmonella typhimurium LT2

Site:
position = -71
score = 5.7879
sequence = TTTTGTGCATTTGCACAATG

Gene: STM0210: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -17
score = 5.10846
sequence = GTTTGTGCAGATGCACAATG

Gene: CKO_03205: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -17
score = 5.40889
sequence = CTTAGTGCAAATGCACAATG

Gene: KPN_00177: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
*
Enterobacter sp. 638

Site:
position = -71
score = 5.30531
sequence = CTTTGTGCATTCGCACAATG

Gene: Ent638_0702: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -80
score = 4.29729
sequence = CTTTGTTAATTTGCACAATG

Gene: ECA3300: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD