Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 45 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 10 3
Salmonella typhimurium LT2 10 3
Citrobacter koseri ATCC BAA-895 10 3
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 10 3
Enterobacter sp. 638 10 3
Erwinia amylovora ATCC 49946 3 2
Yersinia pestis KIM 11 3
Serratia proteamaculans 568 10 3
Erwinia carotovora subsp. atroseptica SCRI1043 9 2
Edwardsiella tarda EIB202 10 3
Proteus mirabilis HI4320 9 2
Photorhabdus luminescens subsp. laumondii TTO1 10 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
erpA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -89
score = 4.94338
sequence = ATACTTGAACGAAATACCAGGGTAT

Gene: b0156: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Salmonella typhimurium LT2

Site:
position = -89
score = 4.89901
sequence = ATACTTGAACGAATTACCAGGGTAT

Gene: STM0204.S: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Citrobacter koseri ATCC BAA-895

Site:
position = -88
score = 5.19351
sequence = ATACTTGAATGAAATACCAGGGTAT

Gene: CKO_03211: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -89
score = 4.6771
sequence = ATACTTGAACGATTTACCAGGGTAT

Gene: KPN_00171: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Enterobacter sp. 638

Site:
position = -87
score = 5.14915
sequence = ATACTTGAATGAATTACCAGGGTAT

Gene: Ent638_0696: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Erwinia amylovora ATCC 49946

Gene: EAM_0810: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Yersinia pestis KIM

Site:
position = -103
score = 5.98651
sequence = GTACTTGAATGAAATACTCAGGTAT

Gene: y0801: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Serratia proteamaculans 568

Site:
position = -97
score = 5.51907
sequence = ATACTTGAACGCAACACTCAGGTAT

Gene: Spro_0783: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3306: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Edwardsiella tarda EIB202

Site:
position = -99
score = 5.82045
sequence = ATACTTGAATGGATTACTCGGGTAT

Gene: ETAE_2776: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
Proteus mirabilis HI4320

Gene: PMI0206: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -105
score = 5.20625
sequence = AAACTTGAACGAACTAATCAGGTAT

Gene: plu0904: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
 
CRON 2.
nfuA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -37
score = 6.8805
sequence = ATAACCAACTAAAATAGTCAACTAT

Gene: b3414: NfuA Fe-S protein maturation
*
Salmonella typhimurium LT2

Site:
position = -37
score = 6.8805
sequence = ATAACCAACTAAAATAGTCAACTAT

Gene: STM3511: NfuA Fe-S protein maturation
*
Citrobacter koseri ATCC BAA-895

Site:
position = -37
score = 6.68207
sequence = ATAACCAAGTAAAATAGTCAACTAT

Gene: CKO_04835: NfuA Fe-S protein maturation
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -37
score = 6.47826
sequence = ATAACCCAGTAAAATAGTCAACTAT

Gene: KPN_03784: NfuA Fe-S protein maturation
*
Enterobacter sp. 638

Site:
position = -37
score = 6.08785
sequence = ATACCCAAGTATTTTAGTCAACTAT

Gene: Ent638_3827: NfuA Fe-S protein maturation
*
Erwinia amylovora ATCC 49946

Site:
position = -37
score = 6.6824
sequence = ATAACCAACTGAATTAGTCAACTAT

Gene: EAM_3259: NfuA Fe-S protein maturation
*
Yersinia pestis KIM

Site:
position = -37
score = 6.33379
sequence = ATAACCGACAAGAGTAGTCAACTAT

Gene: y3903: NfuA Fe-S protein maturation
*
Serratia proteamaculans 568

Site:
position = -46
score = 5.70434
sequence = ATAACCTAGTATAGAAGTCAACTAT

Gene: Spro_4634: NfuA Fe-S protein maturation
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -38
score = 5.64662
sequence = ATAACCGATAAGTGCAGTCAACTAT

Gene: ECA4134: NfuA Fe-S protein maturation
*
Edwardsiella tarda EIB202

Site:
position = -37
score = 5.88631
sequence = ATAACCGACCGGAGAAGTCAACTAT

Gene: ETAE_3288: NfuA Fe-S protein maturation
*
Proteus mirabilis HI4320

Site:
position = -38
score = 6.26426
sequence = ATAACCAACCAGAACAGTCAACTAT

Gene: PMI2926: NfuA Fe-S protein maturation
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -37
score = 6.33119
sequence = ATAACCAACTATAGCAGTCAACTAT

Gene: plu0198: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
 
CRON 3.
iscR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -133
score = 6.70926
sequence = ATACCCGACTAAATCAGTCAAGTAA

Site:
position = -108
score = 5.84037
sequence = ATAGTTGACCAATTTACTCGGGAAT

Gene: b2531: Iron-sulfur cluster regulator IscR
*
Salmonella typhimurium LT2

Site:
position = -107
score = 6.06229
sequence = ATAGTTGACCAAATTACTCGGGAAT

Site:
position = -132
score = 6.53852
sequence = ATACCTGACTAATTTACTCAAGTAA

Gene: STM2544: Iron-sulfur cluster regulator IscR
*
Citrobacter koseri ATCC BAA-895

Site:
position = -132
score = 6.84887
sequence = ATACCTGACTAAATTAGTCAAGTAA

Site:
position = -107
score = 6.02522
sequence = ATAGTTGACTGATTTAGTCGGGAAT

Gene: CKO_00250: Iron-sulfur cluster regulator IscR
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -127
score = 6.77727
sequence = ATACCTGACTAAAACAGTCAAGTAA

Site:
position = -102
score = 6.06229
sequence = ATAGTTGACCAAATTACTCGGGAAT

Gene: KPN_02863: Iron-sulfur cluster regulator IscR
*
Enterobacter sp. 638

Site:
position = -131
score = 6.77727
sequence = ATACCTGACTAAAACAGTCAAGTAA

Site:
position = -106
score = 5.92881
sequence = ATAGTTGACCAATTTAGTCGGGAAT

Gene: Ent638_3028: Iron-sulfur cluster regulator IscR
*
Erwinia amylovora ATCC 49946

Site:
position = -88
score = 5.87945
sequence = ATACTTGACCAATTTACTCGGGAAT

Site:
position = -138
score = 4.88166
sequence = ATAGTTGAGTAAATTACCAGGTTAA

Gene: EAM_2493: Iron-sulfur cluster regulator IscR
*
Yersinia pestis KIM

Site:
position = -29
score = 5.25629
sequence = ATAGTTGAGTGAATTACTAGGTTAA

Site:
position = -4
score = 6.57761
sequence = ATAGTTGACTAAAACACTCAAGAAT

Gene: y1333: Iron-sulfur cluster regulator IscR
*
Serratia proteamaculans 568

Site:
position = -94
score = 5.44909
sequence = ATACTTGAGTAAATTACTAGGTTAA

Site:
position = -69
score = 6.20142
sequence = ATAGTTGACTGATTTACTCAGGAAT

Gene: Spro_3628: Iron-sulfur cluster regulator IscR
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -80
score = 6.24082
sequence = ATAGTTGACTAAAACACTCGGGAAT

Site:
position = -105
score = 5.16957
sequence = ATACTTGAGTGTTTTACTCGGTTAA

Gene: ECA3238: Iron-sulfur cluster regulator IscR
*
Edwardsiella tarda EIB202

Site:
position = -114
score = 5.72339
sequence = ATACCTGACTAAAATAGTAGGATAA

Site:
position = -89
score = 6.55613
sequence = ATAGTTGACTGAAATAGTCAGGAAT

Gene: ETAE_2816: Iron-sulfur cluster regulator IscR
*
Proteus mirabilis HI4320

Site:
position = -88
score = 6.17671
sequence = ATACCTGACTAAAACACTCAGATAA

Site:
position = -63
score = 6.57706
sequence = ATAGTTGACTAAATTACTCAGGAAT

Gene: PMI1861: Iron-sulfur cluster regulator IscR
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -90
score = 5.41002
sequence = ATAGTTGAGTAAATTACTAGGTTAA

Site:
position = -65
score = 6.62142
sequence = ATAGTTGACTAAAATACTCAGGAAT

Gene: plu3284: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2530: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Salmonella typhimurium LT2

Gene: STM2543: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00251: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02862: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Enterobacter sp. 638

Gene: Ent638_3027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Erwinia amylovora ATCC 49946

Gene: EAM_2492: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Yersinia pestis KIM

Gene: y1334: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Serratia proteamaculans 568

Gene: Spro_3627: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3237: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Edwardsiella tarda EIB202

Gene: ETAE_2815: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Proteus mirabilis HI4320

Gene: PMI1860: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3283: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2529: Iron-sulfur cluster assembly scaffold protein IscU
 
Salmonella typhimurium LT2

Gene: STM2542: Iron-sulfur cluster assembly scaffold protein IscU
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00252: Iron-sulfur cluster assembly scaffold protein IscU
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02861: Iron-sulfur cluster assembly scaffold protein IscU
 
Enterobacter sp. 638

Gene: Ent638_3026: Iron-sulfur cluster assembly scaffold protein IscU
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1335: Iron-sulfur cluster assembly scaffold protein IscU
 
Serratia proteamaculans 568

Gene: Spro_3626: Iron-sulfur cluster assembly scaffold protein IscU
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3236: Iron-sulfur cluster assembly scaffold protein IscU
 
Edwardsiella tarda EIB202

Gene: ETAE_2814: Iron-sulfur cluster assembly scaffold protein IscU
 
Proteus mirabilis HI4320

Gene: PMI1859: Iron-sulfur cluster assembly scaffold protein IscU
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3282: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2528: Iron binding protein IscA for iron-sulfur cluster assembly
 
Salmonella typhimurium LT2

Gene: STM2541: Iron binding protein IscA for iron-sulfur cluster assembly
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00253: Iron binding protein IscA for iron-sulfur cluster assembly
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02860: Iron binding protein IscA for iron-sulfur cluster assembly
 
Enterobacter sp. 638

Gene: Ent638_3025: Iron binding protein IscA for iron-sulfur cluster assembly
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1336: Iron binding protein IscA for iron-sulfur cluster assembly
 
Serratia proteamaculans 568

Gene: Spro_3625: Iron binding protein IscA for iron-sulfur cluster assembly
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3235: Iron binding protein IscA for iron-sulfur cluster assembly
 
Edwardsiella tarda EIB202

Gene: ETAE_2813: Iron binding protein IscA for iron-sulfur cluster assembly
 
Proteus mirabilis HI4320

Gene: PMI1858: Iron binding protein IscA for iron-sulfur cluster assembly
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3281: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
y1337
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1337: hypothetical
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
unknown
hscB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2527: co-chaperone protein HscB
 
Salmonella typhimurium LT2

Gene: STM2540: co-chaperone protein HscB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00254: co-chaperone protein HscB
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02859: co-chaperone protein HscB
 
Enterobacter sp. 638

Gene: Ent638_3024: co-chaperone protein HscB
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1338: co-chaperone protein HscB
 
Serratia proteamaculans 568

Gene: Spro_3624: co-chaperone protein HscB
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3234: co-chaperone protein HscB
 
Edwardsiella tarda EIB202

Gene: ETAE_2812: co-chaperone protein HscB
 
Proteus mirabilis HI4320

Gene: PMI1857: co-chaperone protein HscB
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3280: co-chaperone protein HscB
Chaperone protein hscB (HSC20)
hscA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2526: Chaperone protein HscA
 
Salmonella typhimurium LT2

Gene: STM2539: Chaperone protein HscA
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00255: Chaperone protein HscA
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02858: Chaperone protein HscA
 
Enterobacter sp. 638

Gene: Ent638_3023: Chaperone protein HscA
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1339: Chaperone protein HscA
 
Serratia proteamaculans 568

Gene: Spro_3623: Chaperone protein HscA
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3233: Chaperone protein HscA
 
Edwardsiella tarda EIB202

Gene: ETAE_2811: Chaperone protein HscA
 
Proteus mirabilis HI4320

Gene: PMI1856: Chaperone protein HscA
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3279: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2525: ferredoxin, 2Fe-2S type, ISC system
 
Salmonella typhimurium LT2

Gene: STM2538: ferredoxin, 2Fe-2S type, ISC system
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00256: ferredoxin, 2Fe-2S type, ISC system
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02857: ferredoxin, 2Fe-2S type, ISC system
 
Enterobacter sp. 638

Gene: Ent638_3022: ferredoxin, 2Fe-2S type, ISC system
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1340: ferredoxin, 2Fe-2S type, ISC system
 
Serratia proteamaculans 568

Gene: Spro_3622: ferredoxin, 2Fe-2S type, ISC system
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3232: ferredoxin, 2Fe-2S type, ISC system
 
Edwardsiella tarda EIB202

Gene: ETAE_2810: ferredoxin, 2Fe-2S type, ISC system
 
Proteus mirabilis HI4320

Gene: PMI1855: ferredoxin, 2Fe-2S type, ISC system
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3278: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yfhJ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2524: putative Fe-S cluster assembly protein
 
Salmonella typhimurium LT2

Gene: STM2537: putative Fe-S cluster assembly protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00257: putative Fe-S cluster assembly protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02856: putative Fe-S cluster assembly protein
 
Enterobacter sp. 638

Gene: Ent638_3021: putative Fe-S cluster assembly protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1341: putative Fe-S cluster assembly protein
 
Serratia proteamaculans 568

Gene: Spro_3621: putative Fe-S cluster assembly protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3231: putative Fe-S cluster assembly protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2809: putative Fe-S cluster assembly protein
 
Proteus mirabilis HI4320

Gene: PMI1854: putative Fe-S cluster assembly protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3277: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD