Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AscG - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 3 2
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895 5 3
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 9 4
Enterobacter sp. 638 11 5
Erwinia amylovora ATCC 49946 6 2
Yersinia pestis KIM
Serratia proteamaculans 568 6 3
Erwinia carotovora subsp. atroseptica SCRI1043 9 5
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celA2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -117
score = 5.61192
sequence = TACTGCAACCGGTTTCAGTT

Gene: CKO_02999: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -151
score = 5.75845
sequence = AAATGAAACCGGTTTCAATT

Gene: KPN_04369: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Enterobacter sp. 638

Site:
position = -126
score = 5.42311
sequence = AATTGAAACCGGTTTCATAG

Gene: Ent638_0200: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celC2
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03000: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04368: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Enterobacter sp. 638

Gene: Ent638_0199: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
CRON 2.
celA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -72
score = 4.61925
sequence = AATGGAAACCGGTTTCCGTC

Site:
position = -198
score = 4.34116
sequence = TTTGGAAACCGATTTTCCAT

Gene: KPN_04054: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Enterobacter sp. 638

Site:
position = -72
score = 4.73279
sequence = AATGGAAACCGGTTTCCATA

Gene: Ent638_0038: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04055: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Enterobacter sp. 638

Gene: Ent638_0037: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -242
score = 4.53727
sequence = ATGGAAAACGGTTTCCATAT

Gene: ECA2488: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
bglB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_0036: Beta-glucosidase (EC 3.2.1.21)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Beta-glucosidase (EC 3.2.1.21)
celC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04056: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Enterobacter sp. 638

Gene: Ent638_0035: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
bglP
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04057: putative outer membrane porin for beta-glucoside utilization
 
Enterobacter sp. 638

Gene: Ent638_0034: putative outer membrane porin for beta-glucoside utilization
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative outer membrane porin for beta-glucoside utilization
 
CRON 3.
ascF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -177
score = 5.14489
sequence = TCAGGTGACCGGTTTCACAA

Site:
position = -101
score = 5.84427
sequence = TTGTGAAACCGGTTTCTTAA

Gene: b2715: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -103
score = 5.09137
sequence = TTGTGGAACCGGTTTCCTAT

Gene: CKO_04070: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -93
score = 5.09137
sequence = TTGTGGAACCGGTTTCCTAT

Gene: KPN_03051: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
*
Enterobacter sp. 638

Site:
position = -52
score = 5.61162
sequence = TTGTGAAACCGGTTTCCTAT

Gene: Ent638_3188: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -113
score = 5.81364
sequence = TTGTGAAACCGGTTTCTTAT

Gene: Spro_0576: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -180
score = 5.11246
sequence = ATGTGGAACCGGTTACCCAT

Gene: ECA2165: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
ascB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2716: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04071: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03052: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Enterobacter sp. 638

Gene: Ent638_3189: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0575: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2166: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
 
CRON 4.
bglE
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
*
Erwinia amylovora ATCC 49946

Site:
position = -68
score = 6.59023
sequence = ATATGAAACCGGTTGCAGAA

Gene: EAM_2930: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -86
score = 5.4333
sequence = TACTGAAACCGGTTGCTGTT

Site:
position = -99
score = 4.87755
sequence = CCCTGCAACCGGTTACTGAA

Gene: Spro_4224: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -69
score = 6.55959
sequence = ATATGAAACCGGTTGCATAT

Gene: ECA4435: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
bglF
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03430: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04820: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
*
Enterobacter sp. 638

Site:
position = -202
score = 5.03809
sequence = TACAGTAACCGGTTGCAGAG

Site:
position = -215
score = 5.50992
sequence = CACGGAAACCGGTTACAGTA

Gene: Ent638_0526: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946

Gene: EAM_2931: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4223: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4434: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
bglG
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2932: PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4222: PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4433: PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
bglA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 2
Erwinia amylovora ATCC 49946

Gene: EAM_2934: 6-phospho-beta-glucosidase (EC 3.2.1.86)

Gene: EAM_2933: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2500: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4432: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
6-phospho-beta-glucosidase (EC 3.2.1.86)
 
CRON 5.
ascG
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -175
score = 6.34104
sequence = TTAAGAAACCGGTTTCACAA

Gene: b2714: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -172
score = 6.67314
sequence = ATAGGAAACCGGTTCCACAA

Gene: CKO_04069: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -194
score = 6.67314
sequence = ATAGGAAACCGGTTCCACAA

Gene: KPN_03050: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
*
Enterobacter sp. 638

Site:
position = -182
score = 6.71924
sequence = ATAGGAAACCGGTTTCACAA

Gene: Ent638_3187: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
*
Erwinia amylovora ATCC 49946

Site:
position = -297
score = 6.10165
sequence = TTCTGCAACCGGTTTCATAT

Gene: EAM_2929: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -193
score = 6.48083
sequence = ATAAGAAACCGGTTTCACAA

Gene: Spro_0577: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
*2
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -173
score = 6.02897
sequence = ATGGGTAACCGGTTCCACAT

Gene: ECA2164: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family

Site:
position = -164
score = 6.38122
sequence = ATATGCAACCGGTTTCATAT

Gene: ECA4436: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD