Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 30 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 2 2
Salmonella typhimurium LT2 3 3
Citrobacter koseri ATCC BAA-895 2 2
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 3
Enterobacter sp. 638 2 2
Erwinia amylovora ATCC 49946 3 3
Yersinia pestis KIM 3 3
Serratia proteamaculans 568 3 3
Erwinia carotovora subsp. atroseptica SCRI1043 2 2
Edwardsiella tarda EIB202 2 2
Proteus mirabilis HI4320 3 3
Photorhabdus luminescens subsp. laumondii TTO1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cueR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0487: Copper-responsive transcriptional regulator, MerR family
*
Salmonella typhimurium LT2

Site:
position = -33
score = 5.38549
sequence = ACCTTCCAGCAAGGTTAAGGT

Gene: STM0499: Copper-responsive transcriptional regulator, MerR family
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02653: Copper-responsive transcriptional regulator, MerR family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -33
score = 6.17009
sequence = ACCTTCCAGCAAGGGGAAGGT

Gene: KPN_00465: Copper-responsive transcriptional regulator, MerR family
*
Enterobacter sp. 638

Site:
position = -33
score = 5.38549
sequence = ACCTTCCAGCAAGGTTAAGGT

Gene: Ent638_0963: Copper-responsive transcriptional regulator, MerR family
*
Erwinia amylovora ATCC 49946

Site:
position = -33
score = 5.38225
sequence = ACCTTCCATCAAGGGGAACGT

Gene: EAM_1045: Copper-responsive transcriptional regulator, MerR family
*
Yersinia pestis KIM

Site:
position = -33
score = 5.62705
sequence = ACCTTCCAGCAAGGTGAAGGT

Gene: y1094: Copper-responsive transcriptional regulator, MerR family
*
Serratia proteamaculans 568

Site:
position = -33
score = 6.17009
sequence = ACCTTCCAGCAAGGGGAAGGT

Gene: Spro_1151: Copper-responsive transcriptional regulator, MerR family
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -33
score = 5.59474
sequence = ACCTTCTAGCAAGGGGAGGGT

Gene: ECA1194: Copper-responsive transcriptional regulator, MerR family
*
Edwardsiella tarda EIB202

Site:
position = -33
score = 5.74102
sequence = ACCTTCCCGCAAGGTTAAGGT

Gene: ETAE_1040: Copper-responsive transcriptional regulator, MerR family
*
Proteus mirabilis HI4320

Site:
position = -33
score = 6.17009
sequence = ACCTTTCCGCAAGGGGAAGGT

Gene: PMI2172: Copper-responsive transcriptional regulator, MerR family
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -33
score = 6.03927
sequence = ACCTTCCCTCAAGGGTAAGGT

Gene: plu3823: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
cueO
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -73
score = 6.35782
sequence = ACCTTCCCGTAAGGGGAAGGA

Gene: b0123: Multicopper oxidase
*
Salmonella typhimurium LT2

Site:
position = -62
score = 6.48485
sequence = ACCTTCCCGTTAGGGCAGGGT

Gene: STM0168: Multicopper oxidase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -73
score = 6.68105
sequence = ACCTTCCCGTAAGGGGAGGGT

Gene: CKO_03244: Multicopper oxidase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -62
score = 6.43949
sequence = ACCTTCCCGTTACGGTAGGGT

Gene: KPN_00131: Multicopper oxidase
 
Enterobacter sp. 638

Gene: Ent638_0671: Multicopper oxidase
*
Erwinia amylovora ATCC 49946

Site:
position = -62
score = 6.2387
sequence = ACCTTCCCGCTGGGGCAGGGT

Gene: EAM_0777: Multicopper oxidase
*
Yersinia pestis KIM

Site:
position = -210
score = 6.39623
sequence = ACCTTCCCCTAAGAGGAGGGT

Gene: y0777: Multicopper oxidase
*
Serratia proteamaculans 568

Site:
position = -118
score = 6.3497
sequence = ACCTTCCGCTAAGGGGAGGGT

Gene: Spro_3999: Multicopper oxidase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -108
score = 5.58831
sequence = ACCTTCCAGTAAGGGGAGACT

Gene: PMI0159: Multicopper oxidase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0845: Multicopper oxidase
Multicopper oxidase
 
CRON 3.
copA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -67
score = 6.57904
sequence = ACCTTCCCCTTGCTGGAAGGT

Gene: b0484: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Salmonella typhimurium LT2

Site:
position = -97
score = 5.95237
sequence = ACCTTAACCTTGCTGGAAGGT

Gene: STM0498: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -67
score = 6.15979
sequence = ACCTTCCCCTTGATGGAAGGT

Gene: CKO_02665: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -40
score = 6.57904
sequence = ACCTTCCCCTTGCTGGAAGGT

Gene: KPN_00464: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Enterobacter sp. 638

Site:
position = -95
score = 5.95237
sequence = ACCTTAACCTTGCTGGAAGGT

Gene: Ent638_0962: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Erwinia amylovora ATCC 49946

Site:
position = -83
score = 5.60462
sequence = ACGTTCCCCTTGATGGAAGGT

Gene: EAM_1044: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Yersinia pestis KIM

Site:
position = -194
score = 6.3079
sequence = ACCTTCACCTTGCTGGAAGGT

Gene: y1093: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Serratia proteamaculans 568

Site:
position = -93
score = 6.57904
sequence = ACCTTCCCCTTGCTGGAAGGT

Gene: Spro_1150: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -103
score = 5.84184
sequence = ACCCTCCCCTTGCTAGAAGGT

Gene: ECA1193: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Edwardsiella tarda EIB202

Site:
position = -115
score = 6.07857
sequence = ACCTTAACCTTGCGGGAAGGT

Gene: ETAE_1039: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Proteus mirabilis HI4320

Site:
position = -122
score = 6.20482
sequence = ACCTTCCCCTTGCGGAAAGGT

Gene: PMI2173: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -129
score = 5.93045
sequence = ACCTTACCCTTGAGGGAAGGT

Gene: plu3824: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD