Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GalR/GalS - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 78 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 14 6
Salmonella typhimurium LT2 7 4
Citrobacter koseri ATCC BAA-895 17 7
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 17 7
Enterobacter sp. 638 17 7
Erwinia amylovora ATCC 49946 6 4
Yersinia pestis KIM 5 3
Serratia proteamaculans 568 9 5
Erwinia carotovora subsp. atroseptica SCRI1043 12 5
Edwardsiella tarda EIB202 6 3
Proteus mirabilis HI4320 6 3
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
galR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -32
score = 5.23435
sequence = GAATGTAAGCGTTTACCCAC

Gene: b2837: galactose operon repressor galR
*
Salmonella typhimurium LT2

Site:
position = -33
score = 5.34706
sequence = TAATGTAAGCGTTTACCCAC

Gene: STM3011: galactose operon repressor galR
*
Citrobacter koseri ATCC BAA-895

Site:
position = -33
score = 5.10755
sequence = AAATGTAAGCGTTTACCCAC

Gene: CKO_04211: galactose operon repressor galR
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -33
score = 5.4768
sequence = GTATGTAAACGCTTACCCTA

Gene: KPN_03246: galactose operon repressor galR
*
Enterobacter sp. 638

Site:
position = -35
score = 5.28439
sequence = GTGTGTAAACGCTTACCCCC

Gene: Ent638_3278: galactose operon repressor galR
*
Erwinia amylovora ATCC 49946

Site:
position = -35
score = 4.90868
sequence = AAATGTAAACGCTTACCCAG

Gene: EAM_2770: galactose operon repressor galR
*
Yersinia pestis KIM

Site:
position = 32
score = 5.39524
sequence = TGATGTAAGCGGTTACCCTA

Gene: y3183: galactose operon repressor galR
*
Serratia proteamaculans 568

Site:
position = -34
score = 5.19158
sequence = GAATGTAAGCGATTACCCAG

Gene: Spro_3832: galactose operon repressor galR
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -240
score = 5.32283
sequence = AAGTGTAATCGGTTACCCTA

Gene: ECA3172: galactose operon repressor galR
*
Edwardsiella tarda EIB202

Site:
position = -41
score = 5.18282
sequence = TGGTGTAAACGTTTACGGTT

Gene: ETAE_2890: galactose operon repressor galR
*
Proteus mirabilis HI4320

Site:
position = -168
score = 5.32255
sequence = AAGTGTAAACGCTTTCCTTT

Gene: PMI1947: galactose operon repressor galR
 
Photorhabdus luminescens subsp. laumondii TTO1
galactose operon repressor galR
 
CRON 2.
galE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -96
score = 6.56073
sequence = TTGTGTAAACGATTCCACTA

Gene: b0759: UDP-galactose-4-epimerase
*
Salmonella typhimurium LT2

Site:
position = -96
score = 6.44801
sequence = GTGTGTAAACGATTCCACTA

Gene: STM0776: UDP-galactose-4-epimerase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -54
score = 6.38716
sequence = AAGTGTAAACGATTCCACTA

Gene: CKO_02376: UDP-galactose-4-epimerase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -96
score = 6.38716
sequence = AAGTGTAAACGATTCCACTA

Site:
position = -252
score = 4.86571
sequence = CAGTGGAGACGGTTACACTT

Gene: KPN_00773: UDP-galactose-4-epimerase
*
Enterobacter sp. 638

Site:
position = -96
score = 6.23269
sequence = CGGTGTAACCGATTCCACTA

Gene: Ent638_1250: UDP-galactose-4-epimerase
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -95
score = 6.41098
sequence = GAGTGTAAACGATTCCATTA

Gene: y3043: UDP-galactose-4-epimerase
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1389: UDP-galactose-4-epimerase
*
Edwardsiella tarda EIB202

Site:
position = -95
score = 6.42666
sequence = TAGTGTAAACGATTCCATTT

Site:
position = -195
score = 5.46422
sequence = TAGTGTAAGCGATACCACAA

Gene: ETAE_2564: UDP-galactose-4-epimerase
*
Proteus mirabilis HI4320

Site:
position = -126
score = 6.06806
sequence = GCGTGTAAACGTTTACACTA

Site:
position = -259
score = 5.3169
sequence = TAATGTAATCGTTTACTTTT

Gene: PMI1951: UDP-galactose-4-epimerase
 
Photorhabdus luminescens subsp. laumondii TTO1
UDP-galactose-4-epimerase
galT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0758: galactose-1-phosphate uridylyltransferase
 
Salmonella typhimurium LT2

Gene: STM0775: galactose-1-phosphate uridylyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02377: galactose-1-phosphate uridylyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00772: galactose-1-phosphate uridylyltransferase
 
Enterobacter sp. 638

Gene: Ent638_1249: galactose-1-phosphate uridylyltransferase
*
Erwinia amylovora ATCC 49946

Site:
position = -197
score = 5.0752
sequence = CTATGTAATCGTTTTCAACA

Site:
position = -108
score = 6.42666
sequence = TAGTGTAAACGATTCCATTT

Gene: EAM_1197: galactose-1-phosphate uridylyltransferase
 
Yersinia pestis KIM

Gene: y3044: galactose-1-phosphate uridylyltransferase
*
Serratia proteamaculans 568

Site:
position = -50
score = 5.03136
sequence = AGGTGAAAGCGATTACACAC

Site:
position = -160
score = 6.12121
sequence = CTGTGTAAACGATTCCATTT

Gene: Spro_1292: galactose-1-phosphate uridylyltransferase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -240
score = 5.99472
sequence = TAGGGTAACCGATTACACTT

Site:
position = -152
score = 5.01649
sequence = TAGTGAAACTGATTACATTG

Gene: ECA3171: galactose-1-phosphate uridylyltransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_2565: galactose-1-phosphate uridylyltransferase
 
Proteus mirabilis HI4320

Gene: PMI1950: galactose-1-phosphate uridylyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0575: galactose-1-phosphate uridylyltransferase
galactose-1-phosphate uridylyltransferase
galK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0757: galactokinase
 
Salmonella typhimurium LT2

Gene: STM0774: galactokinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02378: galactokinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00771: galactokinase
 
Enterobacter sp. 638

Gene: Ent638_1248: galactokinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1196: galactokinase
 
Yersinia pestis KIM

Gene: y3045: galactokinase
 
Serratia proteamaculans 568

Gene: Spro_1291: galactokinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3170: galactokinase
 
Edwardsiella tarda EIB202

Gene: ETAE_2566: galactokinase
 
Proteus mirabilis HI4320

Gene: PMI1949: galactokinase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0576: galactokinase
galactokinase
galM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0756: galactose-1-epimerase (mutarotase)
 
Salmonella typhimurium LT2

Gene: STM0773: galactose-1-epimerase (mutarotase)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02379: galactose-1-epimerase (mutarotase)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00770: galactose-1-epimerase (mutarotase)
 
Enterobacter sp. 638

Gene: Ent638_1247: galactose-1-epimerase (mutarotase)
 
Erwinia amylovora ATCC 49946

Gene: EAM_1195: galactose-1-epimerase (mutarotase)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1290: galactose-1-epimerase (mutarotase)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1388: galactose-1-epimerase (mutarotase)
 
Edwardsiella tarda EIB202

Gene: ETAE_2567: galactose-1-epimerase (mutarotase)
 
Proteus mirabilis HI4320

Gene: PMI1948: galactose-1-epimerase (mutarotase)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0577: galactose-1-epimerase (mutarotase)
galactose-1-epimerase (mutarotase)
 
CRON 3.
galS
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -113
score = 5.54982
sequence = GGCTGTAACCGTTTCCATTG

Gene: b2151: galactose operon repressor galS
*
Salmonella typhimurium LT2

Site:
position = -121
score = 5.36901
sequence = GGCTGTAACCGTTTCCATCC

Gene: STM2191: galactose operon repressor galS
*
Citrobacter koseri ATCC BAA-895

Site:
position = -124
score = 4.94368
sequence = GCATGTAACCGTTTCCAGCC

Gene: CKO_00640: galactose operon repressor galS
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -127
score = 5.22174
sequence = GGATGTAAACGTTTCCAGCC

Gene: KPN_02589: galactose operon repressor galS
*
Enterobacter sp. 638

Site:
position = -127
score = 5.48274
sequence = GGATGTAACCGTTTTCATCT

Gene: Ent638_2751: galactose operon repressor galS
*
Erwinia amylovora ATCC 49946

Site:
position = -128
score = 4.86789
sequence = GGCTGTAACCGTTTTCATGG

Gene: EAM_2208: galactose operon repressor galS
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -102
score = 5.44047
sequence = GTATGTAAACGTTTTCTTTC

Gene: Spro_1562: galactose operon repressor galS
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
galactose operon repressor galS
 
CRON 4.
galP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -282
score = 4.97665
sequence = AACTGAAACCGATTACACCA

Site:
position = -100
score = 6.18422
sequence = TAGTGTAAGCGATTACACTG

Gene: b2943: galactose transporter
*
Salmonella typhimurium LT2

Site:
position = -283
score = 4.74752
sequence = TCATGAAAGCGGTTACATTC

Site:
position = -101
score = 6.06397
sequence = CAGTGTAAACGATTACACCA

Gene: STM3091: galactose transporter
*
Citrobacter koseri ATCC BAA-895

Site:
position = -282
score = 5.21755
sequence = TAATGAAACCGTTTACCCTC

Site:
position = -101
score = 6.61108
sequence = TAGTGTAAACGATTACACTA

Gene: CKO_04318: galactose transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -285
score = 4.72487
sequence = AAATGAAAGCGATTACATAG

Site:
position = -102
score = 5.56167
sequence = TTGTGGAAACGATTACACAG

Gene: KPN_03376: galactose transporter
*
Enterobacter sp. 638

Site:
position = -284
score = 5.0275
sequence = AAATGAAAGCGATTACACCA

Site:
position = -102
score = 6.26035
sequence = TAGTGTAACCGATTACACCA

Gene: Ent638_3347: galactose transporter
*
Erwinia amylovora ATCC 49946

Site:
position = -170
score = 5.55279
sequence = TGTTGTAACCGGTTACATTC

Gene: EAM_2827: galactose transporter
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -274
score = 4.3191
sequence = GTGTGATATCGGTTACATTT

Site:
position = -100
score = 6.11719
sequence = TTGTGTAATCGTTTCCACTA

Gene: Spro_1160: galactose transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -273
score = 5.55037
sequence = AAGTGAAAACGATTACATTT

Site:
position = -79
score = 6.04436
sequence = GTATGTAAACGATTACATTT

Gene: ETAE_2966: galactose transporter
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
galactose transporter
 
CRON 5.
mglB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -287
score = 5.28164
sequence = CGATGTAACCGCTTTCAATC

Gene: b2150: beta-methylgalactoside ABC transporter, periplasmic binding protein
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -287
score = 5.4813
sequence = GGATGTAACCGCTTTCAATA

Gene: CKO_00641: beta-methylgalactoside ABC transporter, periplasmic binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -256
score = 5.38426
sequence = GGATGTAACCGCTTTCAATT

Gene: KPN_02588: beta-methylgalactoside ABC transporter, periplasmic binding protein
*
Enterobacter sp. 638

Site:
position = -288
score = 5.82043
sequence = TGATGTAACCGTTTTCAATC

Gene: Ent638_2750: beta-methylgalactoside ABC transporter, periplasmic binding protein
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -229
score = 5.83294
sequence = TTGTGTAACCGGTTTCAATC

Gene: y2662: beta-methylgalactoside ABC transporter, periplasmic binding protein
*
Serratia proteamaculans 568

Site:
position = -246
score = 6.0539
sequence = TTGTGTAACCGTTTTCAATC

Gene: Spro_1563: beta-methylgalactoside ABC transporter, periplasmic binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
beta-methylgalactoside ABC transporter, periplasmic binding protein
mglA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2149: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00642: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02587: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Enterobacter sp. 638

Gene: Ent638_2749: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2661: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Serratia proteamaculans 568

Gene: Spro_1564: beta-methylgalactoside ABC transporter, ATP-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
beta-methylgalactoside ABC transporter, ATP-binding protein
mglC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2148: beta-methylgalactoside ABC transporter, inner membrane component
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00643: beta-methylgalactoside ABC transporter, inner membrane component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02586: beta-methylgalactoside ABC transporter, inner membrane component
 
Enterobacter sp. 638

Gene: Ent638_2748: beta-methylgalactoside ABC transporter, inner membrane component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2660: beta-methylgalactoside ABC transporter, inner membrane component
 
Serratia proteamaculans 568

Gene: Spro_1565: beta-methylgalactoside ABC transporter, inner membrane component
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
beta-methylgalactoside ABC transporter, inner membrane component
 
CRON 6.
ytfQ
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -147
score = 4.63351
sequence = AGATGAAAGCGATTACAAAC

Site:
position = 0
score = 4.47592
sequence = ATGTGGAAACGCTTACTTAT

Gene: b4227: periplasmic binding protein/LacI transcriptional regulator
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -148
score = 4.74486
sequence = GAATGAAAGCGATTACAAAG

Site:
position = 0
score = 4.55632
sequence = ATGTGGAAGCGCTTACTTTT

Gene: CKO_03603: periplasmic binding protein/LacI transcriptional regulator
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -283
score = 5.84584
sequence = TTATGTAACCGTTTTCATTG

Site:
position = -42
score = 4.24872
sequence = ATGTGGAAGCGCTTACTTCT

Gene: KPN_04622: periplasmic binding protein/LacI transcriptional regulator
*
Enterobacter sp. 638

Site:
position = -148
score = 4.87165
sequence = GAATGAAAGCGATTACAAAC

Site:
position = -94
score = 4.31832
sequence = TGATGTAACGCATTCCGTTA

Site:
position = 0
score = 4.14191
sequence = ATGTGGAAGCGCTTACTACT

Gene: Ent638_0412: periplasmic binding protein/LacI transcriptional regulator
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
periplasmic binding protein/LacI transcriptional regulator
ytfR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4485: putative sugar transport protein (ABC superfamily, atp_bind)
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03602: putative sugar transport protein (ABC superfamily, atp_bind)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04623: putative sugar transport protein (ABC superfamily, atp_bind)
 
Enterobacter sp. 638

Gene: Ent638_0413: putative sugar transport protein (ABC superfamily, atp_bind)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative sugar transport protein (ABC superfamily, atp_bind)
ytfT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4230: putative sugar transport protein (ABC superfamily, membrane)
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03601: putative sugar transport protein (ABC superfamily, membrane)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04624: putative sugar transport protein (ABC superfamily, membrane)
 
Enterobacter sp. 638

Gene: Ent638_0414: putative sugar transport protein (ABC superfamily, membrane)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative sugar transport protein (ABC superfamily, membrane)
yjfF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4231: inner membrane ABC transporter permease protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03600: inner membrane ABC transporter permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04625: inner membrane ABC transporter permease protein
 
Enterobacter sp. 638

Gene: Ent638_0415: inner membrane ABC transporter permease protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
inner membrane ABC transporter permease protein
 
CRON 7.
ganK
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00426: oligogalactan ABC transporter, ATP-binding protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3242: oligogalactan ABC transporter, ATP-binding protein
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -178
score = 5.31135
sequence = TTGTGCAAACGGTTACACCA

Gene: ECA3174: oligogalactan ABC transporter, ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalactan ABC transporter, ATP-binding protein
 
CRON 8.
ganE
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00427: oligogalactan ABC transporter, substrate-binding periplasmic protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3241: oligogalactan ABC transporter, substrate-binding periplasmic protein
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -229
score = 4.76604
sequence = TGGTGTAACCGTTACCCTAG

Site:
position = -335
score = 5.60361
sequence = TGGTGTAACCGTTTGCACAA

Gene: ECA3175: oligogalactan ABC transporter, substrate-binding periplasmic protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalactan ABC transporter, substrate-binding periplasmic protein
ganF
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00428: oligogalactan ABC transporter, permease protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3240: oligogalactan ABC transporter, permease protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3176: oligogalactan ABC transporter, permease protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalactan ABC transporter, permease protein
ganG
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00429: oligogalactan ABC transporter, permease protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3239: oligogalactan ABC transporter, permease protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3177: oligogalactan ABC transporter, permease protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oligogalactan ABC transporter, permease protein
ganA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00430: galactanase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3238: galactanase
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3178: galactanase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
galactanase
lacA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00431: beta-galactosidase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3237: beta-galactosidase
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3179: beta-galactosidase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
beta-galactosidase
 
CRON 9.
ECA1400
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -38
score = 4.86055
sequence = ATTTGTAATCGATTACTTTT

Site:
position = -70
score = 5.10006
sequence = TTTTGTAATCGATTACTTTT

Gene: CKO_02603: putative nucleoside H+ symporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -35
score = 5.10006
sequence = TTTTGTAATCGATTACTTTT

Site:
position = -66
score = 5.10006
sequence = TTTTGTAATCGATTACTTTT

Gene: KPN_00538: putative nucleoside H+ symporter
*
Enterobacter sp. 638

Site:
position = -37
score = 5.10006
sequence = TTTTGTAATCGATTACTTTT

Site:
position = -68
score = 5.10006
sequence = TTTTGTAATCGATTACTTTT

Gene: Ent638_1060: putative nucleoside H+ symporter
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -34
score = 5.05328
sequence = GATTGTAATCGATTACTTTT

Site:
position = -64
score = 5.0028
sequence = AAAAGTAATCGATTACATTT

Gene: ECA1400: putative nucleoside H+ symporter
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative nucleoside H+ symporter
ECA1399
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02602: putative xylose isomerase-like TIM barrel
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00539: putative xylose isomerase-like TIM barrel
 
Enterobacter sp. 638

Gene: Ent638_1061: putative xylose isomerase-like TIM barrel
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1399: putative xylose isomerase-like TIM barrel
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative xylose isomerase-like TIM barrel
ECA1398
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02601: putative NADH-dependent dehydrogenase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00540: putative NADH-dependent dehydrogenase
 
Enterobacter sp. 638

Gene: Ent638_1062: putative NADH-dependent dehydrogenase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1398: putative NADH-dependent dehydrogenase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative NADH-dependent dehydrogenase
 
CRON 10.
sglT
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -58
score = 5.70836
sequence = AAGTGGAAACGTTTACATTA

Site:
position = -249
score = 4.7616
sequence = TATTGTAACCGTTATCAAAC

Gene: PMI1946: predicted sodium/galactose cotransporter
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted sodium/galactose cotransporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD