Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 106 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 11 8
Salmonella typhimurium LT2 11 8
Citrobacter koseri ATCC BAA-895 13 10
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 11 8
Enterobacter sp. 638 11 8
Erwinia amylovora ATCC 49946 6 4
Yersinia pestis KIM 6 5
Serratia proteamaculans 568 7 6
Erwinia carotovora subsp. atroseptica SCRI1043 5 4
Edwardsiella tarda EIB202 5 4
Proteus mirabilis HI4320 6 5
Photorhabdus luminescens subsp. laumondii TTO1 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
folA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -182
score = 4.47352
sequence = ACGTAAATCACACTTTACAG

Gene: b0048: Dihydrofolate reductase (EC 1.5.1.3)
 
Salmonella typhimurium LT2

Gene: STM0087: Dihydrofolate reductase (EC 1.5.1.3)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03333: Dihydrofolate reductase (EC 1.5.1.3)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00045: Dihydrofolate reductase (EC 1.5.1.3)
 
Enterobacter sp. 638

Gene: Ent638_0597: Dihydrofolate reductase (EC 1.5.1.3)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0663: Dihydrofolate reductase (EC 1.5.1.3)
 
Yersinia pestis KIM

Gene: y3688: Dihydrofolate reductase (EC 1.5.1.3)
 
Serratia proteamaculans 568

Gene: Spro_0720: Dihydrofolate reductase (EC 1.5.1.3)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3864: Dihydrofolate reductase (EC 1.5.1.3)
 
Edwardsiella tarda EIB202

Gene: ETAE_0597: Dihydrofolate reductase (EC 1.5.1.3)
 
Proteus mirabilis HI4320

Gene: PMI2337: Dihydrofolate reductase (EC 1.5.1.3)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0606: Dihydrofolate reductase (EC 1.5.1.3)
Dihydrofolate reductase (EC 1.5.1.3)
 
CRON 2.
tyrR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -89
score = 3.71545
sequence = GTGTCAATGATTGTTGACAG

Gene: b1323: Transcriptional regulator of aromatic amino acid biosynthesis
*
Salmonella typhimurium LT2

Site:
position = -89
score = 4.24636
sequence = CTGTCAATATTTGTTGACAG

Gene: STM1683: Transcriptional regulator of aromatic amino acid biosynthesis
*
Citrobacter koseri ATCC BAA-895

Site:
position = -90
score = 4.18501
sequence = CTGTCAATAATTGTTGACAG

Gene: CKO_01393: Transcriptional regulator of aromatic amino acid biosynthesis
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -90
score = 4.18501
sequence = CTGTCAATAATTGTTGACAG

Gene: KPN_01305: Transcriptional regulator of aromatic amino acid biosynthesis
*
Enterobacter sp. 638

Site:
position = -86
score = 3.74255
sequence = CTGTCAATATCTGTTGACAG

Gene: Ent638_2152: Transcriptional regulator of aromatic amino acid biosynthesis
*
Erwinia amylovora ATCC 49946

Site:
position = -96
score = 3.89869
sequence = CTGTCAACTTTTCATGACAG

Gene: EAM_1834: Transcriptional regulator of aromatic amino acid biosynthesis
 
Yersinia pestis KIM

Gene: y1988: Transcriptional regulator of aromatic amino acid biosynthesis
*
Serratia proteamaculans 568

Site:
position = -98
score = 3.63207
sequence = CTGTCAACTTTTGCTGACAG

Gene: Spro_2617: Transcriptional regulator of aromatic amino acid biosynthesis
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1989: Transcriptional regulator of aromatic amino acid biosynthesis
 
Edwardsiella tarda EIB202

Gene: ETAE_1860: Transcriptional regulator of aromatic amino acid biosynthesis
*
Proteus mirabilis HI4320

Site:
position = -96
score = 3.72064
sequence = GTGTCAACTTTTGCTGACAA

Gene: PMI1369: Transcriptional regulator of aromatic amino acid biosynthesis
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -178
score = 3.67604
sequence = TTTTATAATCAATCTTACAA

Gene: plu2580: Transcriptional regulator of aromatic amino acid biosynthesis
Transcriptional regulator of aromatic amino acid biosynthesis
 
CRON 3.
COG2814
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -65
score = 4.90211
sequence = TAGTAATTTTTGATTTACAC

Site:
position = -87
score = 4.38878
sequence = GAGTATTGAATTGTTTACGA

Gene: CKO_03376: Predicted tyrosine transporter, COG2814 family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -60
score = 4.41759
sequence = TAGTGATTTTTACTTTACAC

Site:
position = -82
score = 3.90884
sequence = GTGTGCCGTTTTATTTACGA

Gene: KPN_00010: Predicted tyrosine transporter, COG2814 family
*
Enterobacter sp. 638

Site:
position = -37
score = 4.44249
sequence = CTGTAAAATTAAATCAACAA

Site:
position = -60
score = 4.8874
sequence = TAGTAATTTTTTCTTTACGA

Gene: Ent638_0572: Predicted tyrosine transporter, COG2814 family
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -68
score = 4.23904
sequence = TAGTCATGTTAACTTTACAA

Gene: y3709: Predicted tyrosine transporter, COG2814 family
*
Serratia proteamaculans 568

Site:
position = -65
score = 3.97913
sequence = TAGTAAGGATTCGTTTACAG

Site:
position = -87
score = 3.65227
sequence = GTGTGAAAATAATTTGCCGT

Gene: Spro_0690: Predicted tyrosine transporter, COG2814 family
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -68
score = 5.0033
sequence = TAGTAATTTATACTTTACAC

Site:
position = -90
score = 3.99158
sequence = GTGTATAAAAATTTTGCCGA

Gene: ECA3884: Predicted tyrosine transporter, COG2814 family
*
Edwardsiella tarda EIB202

Site:
position = -66
score = 3.65104
sequence = TTATATTTCTATTTTTGCAA

Gene: ETAE_0574: Predicted tyrosine transporter, COG2814 family
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Predicted tyrosine transporter, COG2814 family
 
CRON 4.
tyrP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -110
score = 5.56051
sequence = TTGTACATTTATATTTACAC

Gene: b1907: Tyrosine-specific transport protein
*
Salmonella typhimurium LT2

Site:
position = -110
score = 5.1203
sequence = CTGTAAATTTTACAGTACAC

Gene: STM1937: Tyrosine-specific transport protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -83
score = 4.6082
sequence = TCGTAAACAATGGTATACAC

Gene: CKO_01040: Tyrosine-specific transport protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -110
score = 5.25081
sequence = ATGTAAACATTTCATTACAC

Gene: KPN_02404: Tyrosine-specific transport protein
*
Enterobacter sp. 638

Site:
position = -44
score = 5.13028
sequence = TCGTAAACATTTCATTACAC

Gene: Ent638_2489: Tyrosine-specific transport protein
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -266
score = 5.4479
sequence = tcGTAAAcTatAATTTACAC

Gene: y2979: Tyrosine-specific transport protein
*
Serratia proteamaculans 568

Site:
position = -124
score = 4.75279
sequence = GCGTAAACTTAAGTTAACAC

Gene: Spro_3276: Tyrosine-specific transport protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -235
score = 5.77953
sequence = GTGTAAATATAAAATTACAC

Gene: ECA1218: Tyrosine-specific transport protein
*
Edwardsiella tarda EIB202

Site:
position = -106
score = 5.13454
sequence = GTGTAAATGAATAATTACAT

Gene: ETAE_2350: Tyrosine-specific transport protein
*
Proteus mirabilis HI4320

Site:
position = -106
score = 5.28136
sequence = TTGTAAACAAAACATTACAC

Site:
position = -83
score = 4.69202
sequence = TCGTAATTAAAATTTGACAG

Gene: PMI1738: Tyrosine-specific transport protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -110
score = 5.68159
sequence = TTGTAATTATTTATTTACAC

Gene: plu3066: Tyrosine-specific transport protein
Tyrosine-specific transport protein
 
CRON 5.
aroL
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -182
score = 5.61055
sequence = ATGTAATTTATTATTTACAC

Site:
position = -106
score = 4.99756
sequence = GTGGAATTTTTTCTTTACAA

Gene: b0388: Shikimate kinase III (EC 2.7.1.71)
*
Salmonella typhimurium LT2

Site:
position = -181
score = 5.40079
sequence = ATGTAATGAAAAATTTACAG

Site:
position = -107
score = 5.75492
sequence = GTGTAAATTATTATTTACAT

Gene: STM0388: Shikimate kinase III (EC 2.7.1.71)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -163
score = 4.967
sequence = GTGGAATGATTTATTTACAT

Site:
position = -238
score = 5.36458
sequence = ATGTAATGTTATTTTTACAC

Gene: CKO_02783: Shikimate kinase III (EC 2.7.1.71)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -165
score = 4.63447
sequence = ATGCAATGATAAGTTTACAT

Site:
position = -101
score = 5.31752
sequence = GTGTAATTTTTTCTTTACGT

Gene: KPN_00332: Shikimate kinase III (EC 2.7.1.71)
*
Enterobacter sp. 638

Site:
position = -108
score = 4.90653
sequence = CTGTAATCCAATTTTTACAA

Site:
position = -182
score = 4.53481
sequence = ATGCAATGATTTCTTTACAG

Gene: Ent638_0859: Shikimate kinase III (EC 2.7.1.71)
*
Erwinia amylovora ATCC 49946

Site:
position = -126
score = 4.52112
sequence = CTGTAAATAAAACGTTACTG

Gene: EAM_0932: Shikimate kinase III (EC 2.7.1.71)
*
Yersinia pestis KIM

Site:
position = -174
score = 5.03708
sequence = GTGTATTATTAATTTTACGT

Gene: y0972: Shikimate kinase III (EC 2.7.1.71)
*
Serratia proteamaculans 568

Site:
position = -122
score = 4.86166
sequence = TCGTAAATATTGAAATACAG

Gene: Spro_1018: Shikimate kinase III (EC 2.7.1.71)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1103: Shikimate kinase III (EC 2.7.1.71)
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -57
score = 5.50553
sequence = TTGTAAATTTTAGATTACAC

Gene: PMI0371: Shikimate kinase III (EC 2.7.1.71)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -69
score = 4.0764
sequence = ATGTAAATTTCTGGTTACTA

Gene: plu1245: Shikimate kinase III (EC 2.7.1.71)
Shikimate kinase III (EC 2.7.1.71)
yaiA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0389: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0389: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02782: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00333: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_0860: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
aroM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0390: AroM family protein
 
Salmonella typhimurium LT2

Gene: STM0390: AroM family protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02781: AroM family protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00334: AroM family protein
 
Enterobacter sp. 638

Gene: Ent638_0861: AroM family protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0937: AroM family protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1025: AroM family protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
AroM family protein
 
CRON 6.
mtr
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -129
score = 5.3368
sequence = CTGTAAAATAATATATACAG

Gene: b3161: Tryptophan-specific transport protein
*
Salmonella typhimurium LT2

Site:
position = -129
score = 5.20516
sequence = GCGTAAAGTAAAATATACAG

Gene: STM3279: Tryptophan-specific transport protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -129
score = 5.14779
sequence = CCGTAAAGTAAAATATACAG

Gene: CKO_04558: Tryptophan-specific transport protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -128
score = 4.92266
sequence = GCGTAAACTAAATAATACAG

Gene: KPN_03569: Tryptophan-specific transport protein
*
Enterobacter sp. 638

Site:
position = -128
score = 5.19473
sequence = GCGTAAAGTAATATATACAG

Gene: Ent638_3598: Tryptophan-specific transport protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1150: Tryptophan-specific transport protein
 
Yersinia pestis KIM

Gene: y2900: Tryptophan-specific transport protein
 
Serratia proteamaculans 568

Gene: Spro_3236: Tryptophan-specific transport protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0872: Tryptophan-specific transport protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2287: Tryptophan-specific transport protein
 
Proteus mirabilis HI4320

Gene: PMI0836: Tryptophan-specific transport protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2860: Tryptophan-specific transport protein
Tryptophan-specific transport protein
 
CRON 7.
aroF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -165
score = 5.39672
sequence = GTGTAAATTTATCTATACAG

Site:
position = -113
score = 5.35852
sequence = GTGTAAATAAAAATGTACGA

Site:
position = -90
score = 4.03726
sequence = ATGGATTGAAAACTTTACTT

Gene: b2601: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Salmonella typhimurium LT2

Site:
position = -164
score = 4.4821
sequence = GTGTAAAGTTTTTGATACGA

Site:
position = -113
score = 5.31738
sequence = GTGTAAAGTTTATTTTACGT

Site:
position = -90
score = 4.02682
sequence = ATGGATTGAAATCTTTACTT

Gene: STM2670: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -89
score = 4.00067
sequence = GTGGATTGAAATCTTTACCG

Site:
position = -165
score = 5.31223
sequence = ATGTAAATTTTTATGTACGA

Site:
position = -112
score = 5.41495
sequence = ATGTAAAGTAAAATTTACGG

Gene: CKO_03921: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -90
score = 3.96548
sequence = ATGGATTGAATTCTTTACTT

Site:
position = -166
score = 4.93463
sequence = GTGTAAATATTGTTATACGC

Site:
position = -113
score = 5.67497
sequence = GTGTAAATTAAAATTTACGG

Gene: KPN_02923: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Enterobacter sp. 638

Site:
position = -112
score = 5.67497
sequence = GTGTAAATTAAAATTTACGG

Site:
position = -89
score = 4.03587
sequence = TTGGATTGAAATCTTTACTG

Site:
position = -165
score = 5.35843
sequence = CTGTAATTTTATGTTTACGA

Gene: Ent638_3080: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Erwinia amylovora ATCC 49946

Site:
position = -73
score = 3.99934
sequence = ATGTACTCATTATGGTACAG

Site:
position = -202
score = 5.32325
sequence = CTGTAATCTTTTATTTACGC

Site:
position = -106
score = 4.14326
sequence = CTGGTAATTAATGTGTACAC

Gene: EAM_2621: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Yersinia pestis KIM

Site:
position = -114
score = 5.23135
sequence = TAGTAATTATTTATTTACAA

Site:
position = -92
score = 4.46133
sequence = ATGGATTGAAAACTTTACAT

Gene: y0903: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Serratia proteamaculans 568

Site:
position = -99
score = 4.55454
sequence = TCGGATTTAAAACTTTACAT

Site:
position = -122
score = 5.14921
sequence = TGGTAATTTTTTATTTACAG

Gene: Spro_0879: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -133
score = 4.5592
sequence = GTGGATTTAAATCTTTACGG

Site:
position = -156
score = 5.20658
sequence = TGGTAATTTTTTATTTACAC

Gene: ECA3352: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Edwardsiella tarda EIB202

Site:
position = -129
score = 4.64097
sequence = GTGTAAAGATGAATGTACGA

Site:
position = -95
score = 4.04299
sequence = ATGGATTGAAAAGTTTACTG

Site:
position = -117
score = 4.59175
sequence = ATGTACGATATTGTTTACAT

Gene: ETAE_2837: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Proteus mirabilis HI4320

Site:
position = -244
score = 5.57766
sequence = GTGTAAAATTAAAATTACAG

Site:
position = -127
score = 5.16215
sequence = ATGTAAACATATGATTACGA

Site:
position = -85
score = 4.4509
sequence = ATGGATTGATTTCTTTACAT

Gene: PMI0387: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -98
score = 4.29958
sequence = TTGGATTGTATTCTTTACGA

Site:
position = -140
score = 5.52075
sequence = TTGTAAACAATAATTTACAG

Gene: plu1262: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2600: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Salmonella typhimurium LT2

Gene: STM2669: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03920: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02922: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Enterobacter sp. 638

Gene: Ent638_3079: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Erwinia amylovora ATCC 49946

Gene: EAM_2620: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Yersinia pestis KIM

Gene: y0904: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Serratia proteamaculans 568

Gene: Spro_0880: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3351: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Edwardsiella tarda EIB202

Gene: ETAE_2836: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Proteus mirabilis HI4320

Gene: PMI0388: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1263: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
CRON 8.
aroP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -89
score = 5.02736
sequence = ATGTAAACAAATTAATACAA

Gene: b0112: Aromatic amino acid transport protein AroP
*
Salmonella typhimurium LT2

Site:
position = -108
score = 5.1856
sequence = TTGTAAATAAATCAATACAA

Gene: STM0150: Aromatic amino acid transport protein AroP
*
Citrobacter koseri ATCC BAA-895

Site:
position = -87
score = 4.99435
sequence = GcGTAAAcaTAttaaTACAa

Gene: CKO_03262: Aromatic amino acid transport protein AroP
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -192
score = 4.79606
sequence = CCGTAAACAAAACAATACAG

Gene: KPN_00116: Aromatic amino acid transport protein AroP
*
Enterobacter sp. 638

Site:
position = -87
score = 4.40474
sequence = CCGTAACGAAATAAATACAT

Site:
position = -64
score = 4.54299
sequence = ATGGAATTTCATAATTACAC

Gene: Ent638_0658: Aromatic amino acid transport protein AroP
*
Erwinia amylovora ATCC 49946

Site:
position = -187
score = 4.36706
sequence = GCGTAAAGTTTCCAATACAC

Gene: EAM_0745: Aromatic amino acid transport protein AroP
*
Yersinia pestis KIM

Site:
position = -234
score = 5.32017
sequence = GTGTAATTAAATGATTACAT

Gene: y0765: Aromatic amino acid transport protein AroP
*
Serratia proteamaculans 568

Site:
position = -80
score = 4.4033
sequence = CCGTAAATAAAACAAAACAC

Gene: Spro_4013: Aromatic amino acid transport protein AroP
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -93
score = 5.42658
sequence = CCGTAAAAATAAAATTACAC

Gene: ECA3791: Aromatic amino acid transport protein AroP
*
Edwardsiella tarda EIB202

Site:
position = -91
score = 5.4115
sequence = ATGTAAAAATAAAATTACGA

Gene: ETAE_0657: Aromatic amino acid transport protein AroP
*
Proteus mirabilis HI4320

Site:
position = -51
score = 5.12255
sequence = TCGTAAACATTGATTTACAC

Gene: PMI1596: Aromatic amino acid transport protein AroP
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2785: Aromatic amino acid transport protein AroP
Aromatic amino acid transport protein AroP
 
CRON 9.
ompF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -75
score = 4.96012
sequence = CCGTAAATTTTTATTGACAG

Gene: b0929: outer membrane porin F
*
Salmonella typhimurium LT2

Site:
position = -77
score = 4.74639
sequence = CTGTAAAGTTTTATTGACGG

Gene: STM0999: outer membrane porin F
*
Citrobacter koseri ATCC BAA-895

Site:
position = -76
score = 4.96012
sequence = ccGTAAATTTttATTgACAg

Gene: CKO_02137: outer membrane porin F
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -77
score = 4.46896
sequence = CCGGAAATATTTATTGACAG

Gene: Ent638_1448: outer membrane porin F
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
outer membrane porin F
 
CRON 10.
tpl
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -307
score = 4.34376
sequence = CTGGAAAGTTAAGTTTTCAC

Gene: CKO_03467: Tyrosine phenol-lyase (EC 4.1.99.2)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Tyrosine phenol-lyase (EC 4.1.99.2)
 
CRON 11.
ipdC
 
Escherichia coli str. K-12 substr. MG1655
*
Salmonella typhimurium LT2

Site:
position = -100
score = 4.53897
sequence = CTGTAAACATTGTTTTCCAG

Gene: STM2405: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -101
score = 3.80347
sequence = CTGTAAATCCTGCTTTCCAC

Gene: CKO_00409: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -97
score = 4.98754
sequence = GCGTAATTATTGCTTTACAC

Gene: KPN_02740: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946

Gene: EAM_2375: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3412: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD