Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Crp - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2301 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655 473 245
Salmonella typhimurium LT2 401 207
Citrobacter koseri ATCC BAA-895 367 204
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 378 196
Enterobacter sp. 638 327 186
Erwinia amylovora ATCC 49946 140 73
Yersinia pestis KIM 214 121
Serratia proteamaculans 568 283 148
Erwinia carotovora subsp. atroseptica SCRI1043 175 105
Edwardsiella tarda EIB202 169 93
Proteus mirabilis HI4320 210 122
Photorhabdus luminescens subsp. laumondii TTO1 155 98
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
crp
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -136
score = 3.30483
sequence = GTATGCAAAGGACGTCACATTA

Site:
position = -154
score = 3.32658
sequence = TACATTGATGTACTGCATGTAT

Gene: b3357: cyclic AMP receptor protein
*
Salmonella typhimurium LT2

Site:
position = -159
score = 3.06994
sequence = TACATTGACGTACTGCATGTAT

Gene: STM3466: cyclic AMP receptor protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -160
score = 3.06994
sequence = TACATTGACGTACTGCATGTAT

Gene: CKO_04777: cyclic AMP receptor protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -158
score = 3.32658
sequence = TACATTGATGTACTGCATGTAT

Gene: KPN_03743: cyclic AMP receptor protein
*
Enterobacter sp. 638

Site:
position = -128
score = 2.93239
sequence = AAACATTACAGGCTGCAAACAT

Gene: Ent638_3784: cyclic AMP receptor protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_3225: cyclic AMP receptor protein
*
Yersinia pestis KIM

Site:
position = -309
score = 2.99486
sequence = AATTTAGACTACCCTTTCATTT

Gene: y3956: cyclic AMP receptor protein
*
Serratia proteamaculans 568

Site:
position = -121
score = 3.46733
sequence = ATTTATGACACGCCTCAAAACC

Gene: Spro_4580: cyclic AMP receptor protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4064: cyclic AMP receptor protein
 
Edwardsiella tarda EIB202

Gene: ETAE_3299: cyclic AMP receptor protein
*
Proteus mirabilis HI4320

Site:
position = -135
score = 3.33614
sequence = TATTATAATCTATTCCTTATTA

Gene: PMI2820: cyclic AMP receptor protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0395: cyclic AMP receptor protein
cyclic AMP receptor protein
 
CRON 2.
fadL
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -269
score = 4.77135
sequence = ATAAGTGACCGAAATCACACTT

Site:
position = -247
score = 3.92274
sequence = AAAAATGATCTAAAACAAAATT

Gene: b2344: Long-chain fatty acid transport protein
*
Salmonella typhimurium LT2

Site:
position = -262
score = 4.77794
sequence = TTAAGTGACCGAAATCACACTT

Site:
position = -240
score = 3.92274
sequence = AAAAATGATCTAAAACAAAAAT

Gene: STM2391: Long-chain fatty acid transport protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -263
score = 4.77135
sequence = ATAAGTGACCGAAATCACACTT

Site:
position = -241
score = 3.92274
sequence = AAAAATGATCTAAAACAAAAAT

Gene: CKO_00446: Long-chain fatty acid transport protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -264
score = 4.67493
sequence = TTAAGTGACAGAAATCACACTT

Site:
position = -242
score = 3.92274
sequence = AAAAATGATCTAAAACAAAAAT

Gene: KPN_02726: Long-chain fatty acid transport protein
*
Enterobacter sp. 638

Site:
position = -269
score = 4.18552
sequence = GTAAGTGACCGATATCACACTA

Site:
position = -247
score = 4.0334
sequence = AAAAATGATCTAGCGCAAAAAT

Site:
position = -214
score = 3.73378
sequence = ATGAGTGCGACGGCTCGCATTT

Gene: Ent638_2884: Long-chain fatty acid transport protein
*
Erwinia amylovora ATCC 49946

Site:
position = -194
score = 3.92283
sequence = TTTTGTTAAGCAGATCTCTTTT

Gene: EAM_2348: Long-chain fatty acid transport protein
 
Yersinia pestis KIM

Gene: y1577: Long-chain fatty acid transport protein
*
Serratia proteamaculans 568

Site:
position = -271
score = 5.12035
sequence = TTAAGTGATGGAAATCACAAAT

Site:
position = -196
score = 3.80866
sequence = TTTTGTTAGCCAGATCTCTCTT

Gene: Spro_3381: Long-chain fatty acid transport protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -332
score = 3.76167
sequence = AATTTTTATCTTCCTTATATTT

Site:
position = -262
score = 4.93102
sequence = TTTAGTGATATCAGTCACATTA

Gene: ECA3081: Long-chain fatty acid transport protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2451: Long-chain fatty acid transport protein
*
Proteus mirabilis HI4320

Site:
position = -326
score = 3.68838
sequence = AAGTGTTAATTATCTATCATAA

Site:
position = -186
score = 4.2485
sequence = TAATGTTAACTAAATCCCAAAT

Gene: PMI1810: Long-chain fatty acid transport protein
 
Photorhabdus luminescens subsp. laumondii TTO1
Long-chain fatty acid transport protein
 
CRON 3.
aaeR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -37
score = 5.27435
sequence = TTATGTGATCTAAATCACTTTT

Gene: b3243: LysR-family transcriptional regulator
*
Salmonella typhimurium LT2

Site:
position = -37
score = 5.27435
sequence = TTATGTGATCTAAATCACTTTT

Gene: STM3367: LysR-family transcriptional regulator
*
Citrobacter koseri ATCC BAA-895

Site:
position = -37
score = 5.26777
sequence = ATATGTGATCTAAATCACTTTT

Gene: CKO_04651: LysR-family transcriptional regulator
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -55
score = 5.06331
sequence = ATGTGTGATCTAAATCACTTTT

Gene: KPN_03652: LysR-family transcriptional regulator
*
Enterobacter sp. 638

Site:
position = -37
score = 5.26777
sequence = ATATGTGATCTAAATCACTTTT

Gene: Ent638_3680: LysR-family transcriptional regulator
*
Erwinia amylovora ATCC 49946

Site:
position = -37
score = 5.31694
sequence = AAATGTGATCTAAATCACTTTT

Gene: EAM_3128: LysR-family transcriptional regulator
*
Yersinia pestis KIM

Site:
position = -55
score = 5.06331
sequence = ATGTGTGATCTAAATCACTTTT

Gene: y0180: LysR-family transcriptional regulator
*
Serratia proteamaculans 568

Site:
position = -37
score = 4.89425
sequence = ATCTGTGATCTAAATCACTTTT

Gene: Spro_4393: LysR-family transcriptional regulator
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -37
score = 5.11907
sequence = TAGTGTGATCTAAATCACTTTT

Gene: ECA0276: LysR-family transcriptional regulator
*
Edwardsiella tarda EIB202

Site:
position = -131
score = 4.51913
sequence = ATCTGTGACGCAAATCACTTTT

Gene: ETAE_3129: LysR-family transcriptional regulator
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
LysR-family transcriptional regulator
 
CRON 4.
ackA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2296: acetate kinase
 
Salmonella typhimurium LT2

Gene: STM2337: acetate kinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00498: acetate kinase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -95
score = 3.82923
sequence = AGGCATGATGTTAATCATAAAT

Gene: KPN_02687: acetate kinase
*
Enterobacter sp. 638

Site:
position = -96
score = 3.83582
sequence = TGGCATGATGTTAATCATAAAT

Gene: Ent638_2840: acetate kinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2301: acetate kinase
 
Yersinia pestis KIM

Gene: y1622: acetate kinase
*
Serratia proteamaculans 568

Site:
position = -125
score = 3.80843
sequence = TCACATGATGTTAATCATAAAT

Gene: Spro_3316: acetate kinase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -95
score = 4.15562
sequence = AGGTATGATGTTAATCATAAAT

Gene: ECA3039: acetate kinase
 
Edwardsiella tarda EIB202

Gene: ETAE_2397: acetate kinase
*
Proteus mirabilis HI4320

Site:
position = -123
score = 3.59806
sequence = AAGCATGATGCGTATCATTAAT

Gene: PMI1771: acetate kinase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -121
score = 3.6342
sequence = TAGCATGATGTTAATCATTTAA

Gene: plu3095: acetate kinase
acetate kinase
pta
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2297: phosphate acetyltransferase
 
Salmonella typhimurium LT2

Gene: STM2338: phosphate acetyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00497: phosphate acetyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02688: phosphate acetyltransferase
 
Enterobacter sp. 638

Gene: Ent638_2841: phosphate acetyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2302: phosphate acetyltransferase
 
Yersinia pestis KIM

Gene: y1620: phosphate acetyltransferase
 
Serratia proteamaculans 568

Gene: Spro_3317: phosphate acetyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3040: phosphate acetyltransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_2398: phosphate acetyltransferase
 
Proteus mirabilis HI4320

Gene: PMI1772: phosphate acetyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3096: phosphate acetyltransferase
phosphate acetyltransferase
 
CRON 5.
acs
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -100
score = 4.05884
sequence = TTGCGTGATCTGTCGCCCAAAT

Gene: b4069: acetyl-coenzyme A synthetase
*
Salmonella typhimurium LT2

Site:
position = -100
score = 4.05884
sequence = TTGCGTGATCTGTCGCCCAAAT

Gene: STM4275: acetyl-coenzyme A synthetase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -101
score = 4.32161
sequence = TTGCGTGATCTGCCGCGCAAAT

Gene: CKO_03816: acetyl-coenzyme A synthetase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -101
score = 3.9461
sequence = TTGCGTGATCTGCCCCCCAATT

Gene: KPN_04478: acetyl-coenzyme A synthetase
*
Enterobacter sp. 638

Site:
position = -101
score = 4.05884
sequence = TTGCGTGATCTGTCGCCCAAAT

Gene: Ent638_0276: acetyl-coenzyme A synthetase
*
Erwinia amylovora ATCC 49946

Site:
position = -98
score = 3.91549
sequence = CTGCGTGATCTGCCGCGCAAAA

Gene: EAM_0327: acetyl-coenzyme A synthetase
*
Yersinia pestis KIM

Site:
position = -97
score = 4.21573
sequence = ATACGTGATCTGCCGCCCAAAA

Gene: y0510: acetyl-coenzyme A synthetase
*
Serratia proteamaculans 568

Site:
position = -97
score = 4.01786
sequence = TTGCGTGATCTGCCGCCCAAAA

Gene: Spro_0297: acetyl-coenzyme A synthetase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -203
score = 5.01366
sequence = TATTGTGACATACATCACTTAT

Site:
position = -97
score = 4.10365
sequence = TTGCGTGATCAATCGCGCAAAA

Gene: ECA0808: acetyl-coenzyme A synthetase
*
Edwardsiella tarda EIB202

Site:
position = -97
score = 4.35642
sequence = TTACGTGATCGTGCGCGCAAAA

Gene: ETAE_0188: acetyl-coenzyme A synthetase
*
Proteus mirabilis HI4320

Site:
position = -97
score = 4.46529
sequence = TTTCGTGATCTTATGCGCAAAA

Gene: PMI3037: acetyl-coenzyme A synthetase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -98
score = 4.21946
sequence = TTGCGTGATCTTCCGCGCAAAA

Gene: plu0074: acetyl-coenzyme A synthetase
acetyl-coenzyme A synthetase
yjcH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4068: membrane protein
 
Salmonella typhimurium LT2

Gene: STM4274: membrane protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03817: membrane protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04477: membrane protein
 
Enterobacter sp. 638

Gene: Ent638_0275: membrane protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0326: membrane protein
 
Yersinia pestis KIM

Gene: y0509: membrane protein
 
Serratia proteamaculans 568

Gene: Spro_0296: membrane protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0807: membrane protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3038: membrane protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0073: membrane protein
membrane protein
actP
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4067: acetate permease
 
Salmonella typhimurium LT2

Gene: STM4273: acetate permease
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03818: acetate permease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04476: acetate permease
 
Enterobacter sp. 638

Gene: Ent638_0274: acetate permease
 
Erwinia amylovora ATCC 49946

Gene: EAM_0325: acetate permease
 
Yersinia pestis KIM

Gene: y0508: acetate permease
 
Serratia proteamaculans 568

Gene: Spro_0295: acetate permease
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0806: acetate permease
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI3039: acetate permease
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0072: acetate permease
acetate permease
 
CRON 6.
aer
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -104
score = 4.95464
sequence = AATTGCGATCTAAATCAAATTA

Gene: b3072: aerotaxis sensor receptor, senses cellular redox state or proton motive force
*
Salmonella typhimurium LT2

Site:
position = -220
score = 3.64731
sequence = AAAGGTGAGCCAGGGCAGATTT

Site:
position = -105
score = 4.02308
sequence = AATTGCGATCCAGAGCAATTTT

Gene: STM3217: aerotaxis sensor receptor, senses cellular redox state or proton motive force
*
Citrobacter koseri ATCC BAA-895

Site:
position = -290
score = 3.86539
sequence = ATTGGTGATGTTTTGCGCAATG

Site:
position = -105
score = 4.98311
sequence = AATTGCGATCTAAATCAAATTT

Gene: CKO_04485: aerotaxis sensor receptor, senses cellular redox state or proton motive force
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -106
score = 4.50412
sequence = AATTGCGATCTGGATCAATTTT

Gene: Ent638_3527: aerotaxis sensor receptor, senses cellular redox state or proton motive force
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
aerotaxis sensor receptor, senses cellular redox state or proton motive force
 
CRON 7.
aldA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -112
score = 4.29647
sequence = TTTTATGAAGCCCTTCACAGAA

Gene: b1415: aldehyde dehydrogenase A
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -137
score = 4.69901
sequence = TTTTATGAAGCACATCACAAAA

Site:
position = -91
score = 3.89054
sequence = ACATGTGATTGTTATTACTTAA

Gene: CKO_01448: aldehyde dehydrogenase A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -137
score = 4.38814
sequence = TTTTATGAATCAGCTCACAGAA

Gene: KPN_01501: aldehyde dehydrogenase A
*
Enterobacter sp. 638

Site:
position = -113
score = 4.67949
sequence = TTTTATGAGATATCTCACAAAA

Gene: Ent638_1953: aldehyde dehydrogenase A
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -36
score = 3.62622
sequence = AAGTATGACGGGTATATCACTT

Gene: ECA0118: aldehyde dehydrogenase A
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
aldehyde dehydrogenase A
 
CRON 8.
ansB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -125
score = 3.97249
sequence = TTTTGTTACCTGCCTCTAACTT

Gene: b2957: periplasmic L-asparaginase II
*
Salmonella typhimurium LT2

Site:
position = -125
score = 4.27744
sequence = TTTTGTTATCCATCTCTAAAAA

Gene: STM3106: periplasmic L-asparaginase II
*
Citrobacter koseri ATCC BAA-895

Site:
position = -125
score = 3.61172
sequence = TTTTGATATCCATCTCTAAAAA

Gene: CKO_04332: periplasmic L-asparaginase II
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2787: periplasmic L-asparaginase II
 
Serratia proteamaculans 568

Gene: Spro_1705: periplasmic L-asparaginase II
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2179: periplasmic L-asparaginase II
*
Proteus mirabilis HI4320

Site:
position = -81
score = 3.62139
sequence = ATTCGTTCTATTTATCACGGAA

Gene: PMI0708: periplasmic L-asparaginase II
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -76
score = 3.78811
sequence = AAGTCTGGTATGTATCACAGAT

Gene: plu1616: periplasmic L-asparaginase II
periplasmic L-asparaginase II
 
CRON 9.
aphA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -130
score = 3.64931
sequence = CATCCTGCTTTTCATCACAAAA

Site:
position = -57
score = 3.96479
sequence = TTTTGCAACAAATCTCACAATA

Gene: b4055: acid phosphatase/phosphotransferase
*
Salmonella typhimurium LT2

Site:
position = -139
score = 3.72856
sequence = TGTTGTGATCATCCTCTTTTTT

Gene: STM4249: acid phosphatase/phosphotransferase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -255
score = 3.86341
sequence = TATTGTGAATGCGTGTACAGAA

Site:
position = -224
score = 3.7049
sequence = GTGTGTGTGGTTTATCACACAT

Gene: CKO_03845: acid phosphatase/phosphotransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04442: acid phosphatase/phosphotransferase
*
Enterobacter sp. 638

Site:
position = -57
score = 3.77771
sequence = TTTTTTGACCATTCGCTCAATT

Gene: Ent638_0259: acid phosphatase/phosphotransferase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -150
score = 5.04512
sequence = TTTTGTGATGAATGTCACGTAT

Site:
position = -98
score = 3.67725
sequence = AACATAGATCATGATCACATTA

Gene: ETAE_3469: acid phosphatase/phosphotransferase
*
Proteus mirabilis HI4320

Site:
position = -148
score = 4.3473
sequence = AAGTGTTAGATAGATCAAAAAA

Site:
position = -87
score = 4.2728
sequence = TAACGTGCGCTATATCTCATTT

Site:
position = -34
score = 4.30202
sequence = TTCTGTGATTAATATAAAAATT

Gene: PMI0729: acid phosphatase/phosphotransferase
 
Photorhabdus luminescens subsp. laumondii TTO1
acid phosphatase/phosphotransferase
 
CRON 10.
araB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -131
score = 3.88372
sequence = TTATTTGCACGGCGTCACACTT

Gene: b0063: L-ribulokinase
*
Salmonella typhimurium LT2

Site:
position = -131
score = 3.78894
sequence = ATATTTGCACAGCGTCACACTT

Gene: STM0103: L-ribulokinase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -132
score = 3.87713
sequence = ATATTTGCACGGCGTCACACTT

Gene: CKO_03319: L-ribulokinase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -130
score = 3.87713
sequence = ATATTTGCACGGCGTCACACTT

Gene: KPN_00062: L-ribulokinase
*
Enterobacter sp. 638

Site:
position = -130
score = 3.79552
sequence = TTATTTGCACAGCGTCACACTT

Gene: Ent638_0610: L-ribulokinase
*
Erwinia amylovora ATCC 49946

Site:
position = -131
score = 4.0827
sequence = ACATATGAAGGCCATCACATAA

Gene: EAM_1697: L-ribulokinase
*
Yersinia pestis KIM

Site:
position = -146
score = 4.32624
sequence = ACTTTTGACTGACATCACAAAA

Gene: y2095: L-ribulokinase
*
Serratia proteamaculans 568

Site:
position = -132
score = 3.88185
sequence = ACTTATGACAGCCGTCACAAAA

Gene: Spro_2244: L-ribulokinase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -133
score = 3.85157
sequence = ACCTTTGACCAGCTTCACAAAA

Gene: ECA2274: L-ribulokinase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-ribulokinase
araA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0062: L-arabinose isomerase
 
Salmonella typhimurium LT2

Gene: STM0102: L-arabinose isomerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03320: L-arabinose isomerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00061: L-arabinose isomerase
 
Enterobacter sp. 638

Gene: Ent638_0609: L-arabinose isomerase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1696: L-arabinose isomerase
 
Yersinia pestis KIM

Gene: y2094: L-arabinose isomerase
 
Serratia proteamaculans 568

Gene: Spro_2243: L-arabinose isomerase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2275: L-arabinose isomerase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-arabinose isomerase
araD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0061: L-ribulose-5-phosphate 4-epimerase
 
Salmonella typhimurium LT2

Gene: STM0101: L-ribulose-5-phosphate 4-epimerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03321: L-ribulose-5-phosphate 4-epimerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00060: L-ribulose-5-phosphate 4-epimerase
 
Enterobacter sp. 638

Gene: Ent638_0608: L-ribulose-5-phosphate 4-epimerase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-ribulose-5-phosphate 4-epimerase
 
CRON 11.
araC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -229
score = 4.41165
sequence = AAGTGTGACGCCGTGCAAATAA

Gene: b0064: DNA-binding transcriptional dual regulator
*
Salmonella typhimurium LT2

Site:
position = -231
score = 4.45518
sequence = AAGTGTGACGCTGTGCAAATAT

Gene: STM0104: DNA-binding transcriptional dual regulator
*
Citrobacter koseri ATCC BAA-895

Site:
position = -230
score = 4.44012
sequence = AAGTGTGACGCCGTGCAAATAT

Gene: CKO_03318: DNA-binding transcriptional dual regulator
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -229
score = 4.44012
sequence = AAGTGTGACGCCGTGCAAATAT

Gene: KPN_00063: DNA-binding transcriptional dual regulator
*
Enterobacter sp. 638

Site:
position = -228
score = 4.42671
sequence = AAGTGTGACGCTGTGCAAATAA

Gene: Ent638_0611: DNA-binding transcriptional dual regulator
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding transcriptional dual regulator
 
CRON 12.
araE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -131
score = 4.36126
sequence = AATTGGAATATCCATCACATAA

Gene: b2841: sugar transporter
*
Salmonella typhimurium LT2

Site:
position = -271
score = 4.02163
sequence = TTTTATGATCTCATTAGCATAG

Site:
position = -131
score = 4.90988
sequence = AAGTGTAATATCCATCACATAT

Gene: STM3016: sugar transporter
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -191
score = 4.43108
sequence = AAGTTTAATGTCCATCACAAAA

Gene: KPN_03264: sugar transporter
*
Enterobacter sp. 638

Site:
position = -209
score = 3.66441
sequence = CGAGATGACATCGATCACATTT

Site:
position = -130
score = 4.05856
sequence = AATTGGAATATCCATCACAGAA

Gene: Ent638_3294: sugar transporter
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
sugar transporter
 
CRON 13.
araF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -163
score = 4.19256
sequence = CGATGTGATATTGCTCTCCTAT

Gene: b1901: L-arabinose-binding periplasmic protein
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -164
score = 3.95758
sequence = CGGTGTGATGCCGCTCTCCTAT

Gene: CKO_01050: L-arabinose-binding periplasmic protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -161
score = 3.95224
sequence = CGATGTGATAATGCTCTCGTAT

Site:
position = -72
score = 3.64592
sequence = TGTTTTGATGACGATTAAATTG

Gene: KPN_02396: L-arabinose-binding periplasmic protein
*
Enterobacter sp. 638

Site:
position = -162
score = 3.69938
sequence = CGGTGTGATGGCGCTCTCTTAT

Gene: Ent638_2476: L-arabinose-binding periplasmic protein
*
Erwinia amylovora ATCC 49946

Site:
position = -251
score = 4.30399
sequence = TTATGTGATGGCCTTCATATGT

Gene: EAM_1698: L-arabinose-binding periplasmic protein
*
Yersinia pestis KIM

Site:
position = -283
score = 4.30433
sequence = TTTTGTGATGTCAGTCAAAAGT

Gene: y2096: L-arabinose-binding periplasmic protein
*
Serratia proteamaculans 568

Site:
position = -251
score = 3.83796
sequence = TTTTGTGACGGCTGTCATAAGT

Gene: Spro_2245: L-arabinose-binding periplasmic protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2273: L-arabinose-binding periplasmic protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-arabinose-binding periplasmic protein
araG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1900: L-arabinose transporter ATP-binding protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01051: L-arabinose transporter ATP-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02395: L-arabinose transporter ATP-binding protein
 
Enterobacter sp. 638

Gene: Ent638_2475: L-arabinose transporter ATP-binding protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1699: L-arabinose transporter ATP-binding protein
 
Yersinia pestis KIM

Gene: y2097: L-arabinose transporter ATP-binding protein
 
Serratia proteamaculans 568

Gene: Spro_2246: L-arabinose transporter ATP-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2272: L-arabinose transporter ATP-binding protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-arabinose transporter ATP-binding protein
araH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4460: L-arabinose transporter permease protein
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01052: L-arabinose transporter permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02394: L-arabinose transporter permease protein
 
Enterobacter sp. 638

Gene: Ent638_2474: L-arabinose transporter permease protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1700: L-arabinose transporter permease protein
 
Yersinia pestis KIM

Gene: y2098: L-arabinose transporter permease protein
 
Serratia proteamaculans 568

Gene: Spro_2247: L-arabinose transporter permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2271: L-arabinose transporter permease protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-arabinose transporter permease protein
 
CRON 14.
argE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -66
score = 3.65727
sequence = TAGTGTATTTTTATTCATAAAT

Gene: b3957: acetylornithine deacetylase
*
Salmonella typhimurium LT2

Site:
position = -66
score = 3.86173
sequence = TAATGTATTTTTATTCATAATT

Gene: STM4120: acetylornithine deacetylase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -27
score = 4.30864
sequence = TAATGTATTTTTATTCACAAAT

Gene: CKO_03037: acetylornithine deacetylase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -27
score = 3.95317
sequence = TATTGTATTTTTATTCAAAATA

Gene: KPN_04246: acetylornithine deacetylase
*
Enterobacter sp. 638

Site:
position = -66
score = 4.18663
sequence = TAGTGTATTTTTATTCACATTT

Gene: Ent638_4029: acetylornithine deacetylase
*
Erwinia amylovora ATCC 49946

Site:
position = -66
score = 3.77839
sequence = TATTGTATTTTTATTCACTATT

Gene: EAM_0137: acetylornithine deacetylase
*
Yersinia pestis KIM

Site:
position = -223
score = 3.64988
sequence = TATTTTTATTTATGTCAATAAA

Gene: y0309: acetylornithine deacetylase
*
Serratia proteamaculans 568

Site:
position = -71
score = 4.30259
sequence = TATTGTATTTTTATTCACAATA

Gene: Spro_4782: acetylornithine deacetylase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -65
score = 3.95317
sequence = TATTGTATTTTTATTCAAAATA

Gene: ECA0191: acetylornithine deacetylase
*
Edwardsiella tarda EIB202

Site:
position = -65
score = 3.88415
sequence = TATTGTATTTTTATTCATAATT

Gene: ETAE_3483: acetylornithine deacetylase
*
Proteus mirabilis HI4320

Site:
position = -65
score = 3.93075
sequence = TAATGTATTTTTATTCAAAAAA

Gene: PMI3236: acetylornithine deacetylase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -65
score = 3.93075
sequence = TAATGTATTTTTATTCAAAAAA

Gene: plu4745: acetylornithine deacetylase
acetylornithine deacetylase
 
CRON 15.
iciA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2916: chromosome replication initiation inhibitor protein
 
Salmonella typhimurium LT2

Gene: STM3064: chromosome replication initiation inhibitor protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04281: chromosome replication initiation inhibitor protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -107
score = 3.80409
sequence = CCCTGCGATGCAGATCACACAA

Gene: KPN_03350: chromosome replication initiation inhibitor protein
*
Enterobacter sp. 638

Site:
position = -126
score = 3.94334
sequence = CCCTGTGACCGGTGTCACATTA

Site:
position = -48
score = 3.71184
sequence = ATTTGTGTCATAGTGCAGAATA

Gene: Ent638_3334: chromosome replication initiation inhibitor protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_2800: chromosome replication initiation inhibitor protein
*
Yersinia pestis KIM

Site:
position = -249
score = 3.66581
sequence = TAATTCTAGCGAGATCACAGTT

Gene: y3303: chromosome replication initiation inhibitor protein
 
Serratia proteamaculans 568

Gene: Spro_3925: chromosome replication initiation inhibitor protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3907: chromosome replication initiation inhibitor protein
*
Edwardsiella tarda EIB202

Site:
position = -48
score = 3.77086
sequence = TAACGTTTTATACATAACAAAA

Gene: ETAE_2951: chromosome replication initiation inhibitor protein
 
Proteus mirabilis HI4320

Gene: PMI2033: chromosome replication initiation inhibitor protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -41
score = 3.58385
sequence = CATAGTGATATTCAGAAAAATA

Gene: plu3610: chromosome replication initiation inhibitor protein
chromosome replication initiation inhibitor protein
 
CRON 16.
argR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3237: arginine repressor
 
Salmonella typhimurium LT2

Gene: STM3360: arginine repressor
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04642: arginine repressor
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03645: arginine repressor
 
Enterobacter sp. 638

Gene: Ent638_3672: arginine repressor
*
Erwinia amylovora ATCC 49946

Site:
position = -91
score = 3.76878
sequence = ATTTGCAATTTGCATAAAAATT

Gene: EAM_3122: arginine repressor
*
Yersinia pestis KIM

Site:
position = -300
score = 3.95447
sequence = ATTAATGAGATAGCGCACATTA

Gene: y0667: arginine repressor
 
Serratia proteamaculans 568

Gene: Spro_0468: arginine repressor
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -172
score = 4.39324
sequence = TTATGTGACTCAGGACGCATTT

Gene: ECA0684: arginine repressor
 
Edwardsiella tarda EIB202

Gene: ETAE_0384: arginine repressor
*
Proteus mirabilis HI4320

Site:
position = -267
score = 3.61627
sequence = TTTTGAGAAATAATTCCAATAA

Site:
position = -129
score = 4.2094
sequence = TTTTTTGAGTTAACACACAAAA

Gene: PMI3399: arginine repressor
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4548: arginine repressor
arginine repressor
 
CRON 17.
aroF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2601: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Salmonella typhimurium LT2

Site:
position = -71
score = 3.93252
sequence = TTTTGTGGTATGGTTTAAACAT

Gene: STM2670: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03921: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -159
score = 3.77919
sequence = TATTGTTATACGCATCGCGCCA

Gene: KPN_02923: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Enterobacter sp. 638

Gene: Ent638_3080: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2621: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Yersinia pestis KIM

Gene: y0903: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Serratia proteamaculans 568

Gene: Spro_0879: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3352: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Edwardsiella tarda EIB202

Site:
position = -117
score = 3.81465
sequence = ATGTACGATATTGTTTACATAT

Gene: ETAE_2837: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Proteus mirabilis HI4320

Site:
position = -214
score = 4.54243
sequence = TTATTTTATCTTAGTCACATTT

Gene: PMI0387: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -262
score = 3.62136
sequence = TGTTTTGATATTGATTTTATTT

Gene: plu1262: phospho-2-dehydro-3-deoxyheptonate aldolase
phospho-2-dehydro-3-deoxyheptonate aldolase
tyrA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2600: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Salmonella typhimurium LT2

Gene: STM2669: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03920: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02922: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Enterobacter sp. 638

Gene: Ent638_3079: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Erwinia amylovora ATCC 49946

Gene: EAM_2620: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Yersinia pestis KIM

Gene: y0904: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Serratia proteamaculans 568

Gene: Spro_0880: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3351: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Edwardsiella tarda EIB202

Gene: ETAE_2836: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Proteus mirabilis HI4320

Gene: PMI0388: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1263: T-protein [includes: chorismate mutase and prephenate dehydrogenase]
T-protein [includes: chorismate mutase and prephenate dehydrogenase]
 
CRON 18.
aroH
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -106
score = 4.29813
sequence = AGGTGTGACACACCTCGCACTT

Site:
position = -64
score = 4.04956
sequence = TATCGTGATGCGCATCACTTCC

Gene: b1704: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Salmonella typhimurium LT2

Site:
position = -106
score = 4.25983
sequence = AGGTGTGACACGCCTCGCACTT

Site:
position = -64
score = 3.96083
sequence = TATCGTGATGCCCATCACTTCC

Gene: STM1347: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -115
score = 4.30741
sequence = AGGTGTGAAACGCCTCGCATTT

Site:
position = -64
score = 4.28721
sequence = TATTGTGATGCCCATCACTTCC

Gene: CKO_01728: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -63
score = 4.04956
sequence = TATCGTGATGCGCATCACTTCC

Gene: KPN_02162: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Enterobacter sp. 638

Site:
position = -126
score = 3.63736
sequence = AGTTATGATCGCTTTCACTCTC

Site:
position = -62
score = 3.64422
sequence = TAAGGTGATGCCCATCACTTCC

Gene: Ent638_1743: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -64
score = 4.25357
sequence = TATTGTGATCGCCATCACTTCC

Gene: y1928: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Serratia proteamaculans 568

Site:
position = -135
score = 3.89619
sequence = TTTTGTGCTTTTTTTAGCGATT

Site:
position = -64
score = 4.25357
sequence = TATTGTGATCGCCATCACTTCC

Gene: Spro_2172: phospho-2-dehydro-3-deoxyheptonate aldolase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1851: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Edwardsiella tarda EIB202

Site:
position = -63
score = 3.99016
sequence = TATCGTGATCCCCATCACTTCC

Gene: ETAE_1792: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Proteus mirabilis HI4320

Site:
position = -55
score = 3.85335
sequence = TATTGTGATCTTAATCACTGGG

Gene: PMI1423: phospho-2-dehydro-3-deoxyheptonate aldolase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -62
score = 3.7972
sequence = TATTGTAATTTCCATTATCTAT

Gene: plu2630: phospho-2-dehydro-3-deoxyheptonate aldolase
phospho-2-dehydro-3-deoxyheptonate aldolase
 
CRON 19.
prpB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -153
score = 3.70452
sequence = AAACGTTAACTGAAACGCATAT

Gene: b0331: Methylisocitrate lyase (EC 4.1.3.30)
*
Salmonella typhimurium LT2

Site:
position = -197
score = 3.51243
sequence = CAGGGTGATTCGTTTCATGAAA

Gene: STM0368: Methylisocitrate lyase (EC 4.1.3.30)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02830: Methylisocitrate lyase (EC 4.1.3.30)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -129
score = 3.55817
sequence = TAATTTAAAAACAATCATATAT

Gene: plu3542: Methylisocitrate lyase (EC 4.1.3.30)
Methylisocitrate lyase (EC 4.1.3.30)
 
CRON 20.
ascF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -177
score = 4.18184
sequence = TCAGGTGACCGGTTTCACAAAT

Gene: b2715: hypothetical protein
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -179
score = 4.4015
sequence = ACAAGTGATCATTCTCACAATT

Gene: CKO_04070: hypothetical protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -168
score = 4.11827
sequence = CTTAGCGATCAAAATCACAAAA

Gene: KPN_03051: hypothetical protein
*
Enterobacter sp. 638

Site:
position = -128
score = 4.39166
sequence = CAAAGTGATCGTTATCACGAAT

Site:
position = -54
score = 3.67236
sequence = TTTTGTGAAACCGGTTTCCTAT

Gene: Ent638_3188: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -189
score = 4.36184
sequence = AAAAGTGACCACCATCACGAAA

Gene: Spro_0576: hypothetical protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -255
score = 3.94319
sequence = CATGGCGATCGTGGTCACATAA

Site:
position = -212
score = 3.85268
sequence = TATTGAAATCGCACTCATATAT

Gene: ECA2165: hypothetical protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ascB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2716: 6-phospho-beta-glucosidase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04071: 6-phospho-beta-glucosidase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03052: 6-phospho-beta-glucosidase
 
Enterobacter sp. 638

Gene: Ent638_3189: 6-phospho-beta-glucosidase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0575: 6-phospho-beta-glucosidase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2166: 6-phospho-beta-glucosidase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
6-phospho-beta-glucosidase
 
CRON 21.
aspA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -206
score = 4.48064
sequence = AGCGGTGATCTATTTCACAAAT

Site:
position = -156
score = 4.22585
sequence = TAAAGTGATCCAGATTACGGTA

Gene: b4139: aspartate ammonia-lyase
*
Salmonella typhimurium LT2

Site:
position = -209
score = 4.19553
sequence = AGCGGTGACCTATTTCACAAAA

Site:
position = -159
score = 4.17667
sequence = TTAAGTGATCCAGATTACGGTA

Gene: STM4326: aspartate ammonia-lyase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -54
score = 4.19553
sequence = AGCGGTGACCTATTTCACAAAA

Gene: CKO_03696: aspartate ammonia-lyase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -204
score = 3.9146
sequence = AGCGGTGACCCATTTCACAGAT

Site:
position = -154
score = 3.75062
sequence = ATAAGTGATCAAGCTTACTGAT

Gene: KPN_04529: aspartate ammonia-lyase
*
Enterobacter sp. 638

Site:
position = -205
score = 4.06823
sequence = AGCGGTGATTCATTTCACAGAT

Gene: Ent638_0326: aspartate ammonia-lyase
*
Erwinia amylovora ATCC 49946

Site:
position = -228
score = 4.16044
sequence = CAATGTGACCTGGAACAGATAT

Gene: EAM_0416: aspartate ammonia-lyase
*
Yersinia pestis KIM

Site:
position = -224
score = 4.62773
sequence = AAGTGTGAGAGCAATCACAGAT

Gene: y0606: aspartate ammonia-lyase
*
Serratia proteamaculans 568

Site:
position = -205
score = 4.66231
sequence = AAACGTGAATGAGATCACAGAA

Gene: Spro_0406: aspartate ammonia-lyase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -272
score = 4.00703
sequence = ACTCGTGACTACAATCACAGTT

Gene: ECA0621: aspartate ammonia-lyase
*
Edwardsiella tarda EIB202

Site:
position = -197
score = 4.37623
sequence = ATCTGTGAGTATTATCACAGAT

Gene: ETAE_0311: aspartate ammonia-lyase
*
Proteus mirabilis HI4320

Site:
position = -206
score = 4.12424
sequence = ATCCATGAGATAGATCACAAAA

Gene: PMI2546: aspartate ammonia-lyase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -274
score = 3.7769
sequence = AGATATAATTGGGGTCACAGTT

Site:
position = -211
score = 5.58859
sequence = AATTGTGATAAATATCACATAT

Gene: plu4137: aspartate ammonia-lyase
aspartate ammonia-lyase
dcuA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4138: anaerobic C-4-dicarboxylate symporter
 
Salmonella typhimurium LT2

Gene: STM4325: anaerobic C-4-dicarboxylate symporter
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03697: anaerobic C-4-dicarboxylate symporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04528: anaerobic C-4-dicarboxylate symporter
 
Enterobacter sp. 638

Gene: Ent638_0325: anaerobic C-4-dicarboxylate symporter
 
Erwinia amylovora ATCC 49946

Gene: EAM_0415: anaerobic C-4-dicarboxylate symporter
 
Yersinia pestis KIM

Gene: y0605: anaerobic C-4-dicarboxylate symporter
 
Serratia proteamaculans 568

Gene: Spro_0405: anaerobic C-4-dicarboxylate symporter
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0620: anaerobic C-4-dicarboxylate symporter
 
Edwardsiella tarda EIB202

Gene: ETAE_0310: anaerobic C-4-dicarboxylate symporter
 
Proteus mirabilis HI4320

Gene: PMI2547: anaerobic C-4-dicarboxylate symporter
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4138: anaerobic C-4-dicarboxylate symporter
anaerobic C-4-dicarboxylate symporter
 
CRON 22.
astC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1748: bifunctional succinylornithine transaminase/acetylornithine transaminase
 
Salmonella typhimurium LT2

Gene: STM1303: bifunctional succinylornithine transaminase/acetylornithine transaminase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01774: bifunctional succinylornithine transaminase/acetylornithine transaminase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -274
score = 3.95116
sequence = TATCTTGATGATCTTCAAAAAG

Gene: KPN_01493: bifunctional succinylornithine transaminase/acetylornithine transaminase
*
Enterobacter sp. 638

Site:
position = -274
score = 3.66837
sequence = AATTTCGCGAGCGATCACAAAT

Gene: Ent638_1696: bifunctional succinylornithine transaminase/acetylornithine transaminase
*
Erwinia amylovora ATCC 49946

Site:
position = -69
score = 4.30991
sequence = ATTTTTAACCTTCATCACACTT

Gene: EAM_1606: bifunctional succinylornithine transaminase/acetylornithine transaminase
 
Yersinia pestis KIM

Gene: y2349: bifunctional succinylornithine transaminase/acetylornithine transaminase
 
Serratia proteamaculans 568

Gene: Spro_2844: bifunctional succinylornithine transaminase/acetylornithine transaminase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -66
score = 3.75687
sequence = AAAGATGATGCGGAGCATATTA

Gene: plu3110: bifunctional succinylornithine transaminase/acetylornithine transaminase
bifunctional succinylornithine transaminase/acetylornithine transaminase
astA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1747: arginine succinyltransferase
 
Salmonella typhimurium LT2

Gene: STM1304: arginine succinyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01773: arginine succinyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01494: arginine succinyltransferase
 
Enterobacter sp. 638

Gene: Ent638_1697: arginine succinyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1607: arginine succinyltransferase
 
Yersinia pestis KIM

Gene: y2348: arginine succinyltransferase
 
Serratia proteamaculans 568

Gene: Spro_2843: arginine succinyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3109: arginine succinyltransferase
arginine succinyltransferase
astD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1746: succinylglutamic semialdehyde dehydrogenase
 
Salmonella typhimurium LT2

Gene: STM1305: succinylglutamic semialdehyde dehydrogenase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01772: succinylglutamic semialdehyde dehydrogenase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01495: succinylglutamic semialdehyde dehydrogenase
 
Enterobacter sp. 638

Gene: Ent638_1698: succinylglutamic semialdehyde dehydrogenase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1608: succinylglutamic semialdehyde dehydrogenase
 
Yersinia pestis KIM

Gene: y2347: succinylglutamic semialdehyde dehydrogenase
 
Serratia proteamaculans 568

Gene: Spro_2842: succinylglutamic semialdehyde dehydrogenase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3108: succinylglutamic semialdehyde dehydrogenase
succinylglutamic semialdehyde dehydrogenase
astB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1745: succinylarginine dihydrolase
 
Salmonella typhimurium LT2

Gene: STM1306: succinylarginine dihydrolase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01771: succinylarginine dihydrolase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01496: succinylarginine dihydrolase
 
Enterobacter sp. 638

Gene: Ent638_1699: succinylarginine dihydrolase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1609: succinylarginine dihydrolase
 
Yersinia pestis KIM

Gene: y2346: succinylarginine dihydrolase
 
Serratia proteamaculans 568

Gene: Spro_2841: succinylarginine dihydrolase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3107: succinylarginine dihydrolase
succinylarginine dihydrolase
astE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1744: succinylglutamate desuccinylase
 
Salmonella typhimurium LT2

Gene: STM1307: succinylglutamate desuccinylase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01770: succinylglutamate desuccinylase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01497: succinylglutamate desuccinylase
 
Enterobacter sp. 638

Gene: Ent638_1700: succinylglutamate desuccinylase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1610: succinylglutamate desuccinylase
 
Yersinia pestis KIM

Gene: y2345: succinylglutamate desuccinylase
 
Serratia proteamaculans 568

Gene: Spro_2840: succinylglutamate desuccinylase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3106: succinylglutamate desuccinylase
succinylglutamate desuccinylase
 
CRON 23.
atpI
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -263
score = 4.79693
sequence = ATATGTGATCTGAAGCACGCTT

Gene: b3739: ATP synthase subunit I
*
Salmonella typhimurium LT2

Site:
position = -262
score = 4.64922
sequence = ATGTGTGATCTGGTGCACGCTT

Site:
position = -211
score = 4.05602
sequence = TTTTGTACGATCGTTCACACTT

Gene: STM3872: ATP synthase subunit I
*
Citrobacter koseri ATCC BAA-895

Site:
position = -262
score = 4.70779
sequence = ATATGTGATCCGAAGCACGCTT

Gene: CKO_00079: ATP synthase subunit I
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -262
score = 4.74828
sequence = TTATGTGATCTGATGCACGCTT

Gene: KPN_04144: ATP synthase subunit I
*
Enterobacter sp. 638

Site:
position = -261
score = 4.79394
sequence = TTTTGTGATCTCGTGCACGCTT

Gene: Ent638_4125: ATP synthase subunit I
*
Erwinia amylovora ATCC 49946

Site:
position = -264
score = 4.38819
sequence = ATTTGTGATCGTGGACACGCTT

Gene: EAM_3481: ATP synthase subunit I
*
Yersinia pestis KIM

Site:
position = -263
score = 5.42488
sequence = TTATGTGATGTATTTCACGTTT

Gene: y4142: ATP synthase subunit I
*
Serratia proteamaculans 568

Site:
position = -265
score = 4.38999
sequence = TATTGTGAGCAACTACACGTTT

Gene: Spro_0001: ATP synthase subunit I
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -254
score = 5.00697
sequence = TTATGTGAGTCACATCACAGAT

Gene: ECA4519: ATP synthase subunit I
*
Edwardsiella tarda EIB202

Site:
position = -297
score = 3.72882
sequence = AATCGTGAAAATATTTAAATTA

Gene: ETAE_3526: ATP synthase subunit I
*
Proteus mirabilis HI4320

Site:
position = -259
score = 5.04378
sequence = TTGTGTGTTCTAGATCACATTA

Gene: PMI3057: ATP synthase subunit I
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -265
score = 5.72401
sequence = TTATGTGATTTAAATCACATTT

Gene: plu0047: ATP synthase subunit I
ATP synthase subunit I
atpB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3738: ATP synthase subunit A
 
Salmonella typhimurium LT2

Gene: STM3871: ATP synthase subunit A
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00078: ATP synthase subunit A
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04143: ATP synthase subunit A
 
Enterobacter sp. 638

Gene: Ent638_4126: ATP synthase subunit A
 
Erwinia amylovora ATCC 49946

Gene: EAM_3480: ATP synthase subunit A
 
Yersinia pestis KIM

Gene: y4141: ATP synthase subunit A
 
Serratia proteamaculans 568

Gene: Spro_0002: ATP synthase subunit A
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4518: ATP synthase subunit A
 
Edwardsiella tarda EIB202

Gene: ETAE_3527: ATP synthase subunit A
 
Proteus mirabilis HI4320

Gene: PMI3058: ATP synthase subunit A
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0046: ATP synthase subunit A
ATP synthase subunit A
atpE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3737: ATP synthase subunit C
 
Salmonella typhimurium LT2

Gene: STM3870: ATP synthase subunit C
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00077: ATP synthase subunit C
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04142: ATP synthase subunit C
 
Enterobacter sp. 638

Gene: Ent638_4127: ATP synthase subunit C
 
Erwinia amylovora ATCC 49946

Gene: EAM_3479: ATP synthase subunit C
 
Yersinia pestis KIM

Gene: y4140: ATP synthase subunit C
 
Serratia proteamaculans 568

Gene: Spro_0003: ATP synthase subunit C
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4517: ATP synthase subunit C
 
Edwardsiella tarda EIB202

Gene: ETAE_3528: ATP synthase subunit C
 
Proteus mirabilis HI4320

Gene: PMI3059: ATP synthase subunit C
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0045: ATP synthase subunit C
ATP synthase subunit C
atpF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3736: ATP synthase subunit B
 
Salmonella typhimurium LT2

Gene: STM3869: ATP synthase subunit B
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00076: ATP synthase subunit B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04141: ATP synthase subunit B
 
Enterobacter sp. 638

Gene: Ent638_4128: ATP synthase subunit B
 
Erwinia amylovora ATCC 49946

Gene: EAM_3478: ATP synthase subunit B
 
Yersinia pestis KIM

Gene: y4139: ATP synthase subunit B
 
Serratia proteamaculans 568

Gene: Spro_0004: ATP synthase subunit B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4516: ATP synthase subunit B
 
Edwardsiella tarda EIB202

Gene: ETAE_3529: ATP synthase subunit B
 
Proteus mirabilis HI4320

Gene: PMI3060: ATP synthase subunit B
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0044: ATP synthase subunit B
ATP synthase subunit B
atpH
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3735: ATP synthase subunit D
 
Salmonella typhimurium LT2

Gene: STM3868: ATP synthase subunit D
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00075: ATP synthase subunit D
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04140: ATP synthase subunit D
 
Enterobacter sp. 638

Gene: Ent638_4129: ATP synthase subunit D
 
Erwinia amylovora ATCC 49946

Gene: EAM_3477: ATP synthase subunit D
 
Yersinia pestis KIM

Gene: y4138: ATP synthase subunit D
 
Serratia proteamaculans 568

Gene: Spro_0005: ATP synthase subunit D
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4515: ATP synthase subunit D
 
Edwardsiella tarda EIB202

Gene: ETAE_3530: ATP synthase subunit D
 
Proteus mirabilis HI4320

Gene: PMI3061: ATP synthase subunit D
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0043: ATP synthase subunit D
ATP synthase subunit D
atpA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3734: ATP synthase subunit A
 
Salmonella typhimurium LT2

Gene: STM3867: ATP synthase subunit A
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00073: ATP synthase subunit A
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04139: ATP synthase subunit A
 
Enterobacter sp. 638

Gene: Ent638_4130: ATP synthase subunit A
 
Erwinia amylovora ATCC 49946

Gene: EAM_3476: ATP synthase subunit A
 
Yersinia pestis KIM

Gene: y4137: ATP synthase subunit A
 
Serratia proteamaculans 568

Gene: Spro_0006: ATP synthase subunit A
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4514: ATP synthase subunit A
 
Edwardsiella tarda EIB202

Gene: ETAE_3531: ATP synthase subunit A
 
Proteus mirabilis HI4320

Gene: PMI3062: ATP synthase subunit A
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0042: ATP synthase subunit A
ATP synthase subunit A
atpG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3733: ATP synthase subunit C
 
Salmonella typhimurium LT2

Gene: STM3866: ATP synthase subunit C
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00071: ATP synthase subunit C
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04138: ATP synthase subunit C
 
Enterobacter sp. 638

Gene: Ent638_4131: ATP synthase subunit C
 
Erwinia amylovora ATCC 49946

Gene: EAM_3475: ATP synthase subunit C
 
Yersinia pestis KIM

Gene: y4136: ATP synthase subunit C
 
Serratia proteamaculans 568

Gene: Spro_0007: ATP synthase subunit C
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4513: ATP synthase subunit C
 
Edwardsiella tarda EIB202

Gene: ETAE_3532: ATP synthase subunit C
 
Proteus mirabilis HI4320

Gene: PMI3063: ATP synthase subunit C
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0041: ATP synthase subunit C
ATP synthase subunit C
atpD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3732: ATP synthase subunit B
 
Salmonella typhimurium LT2

Gene: STM3865: ATP synthase subunit B
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00070: ATP synthase subunit B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04137: ATP synthase subunit B
 
Enterobacter sp. 638

Gene: Ent638_4132: ATP synthase subunit B
 
Erwinia amylovora ATCC 49946

Gene: EAM_3474: ATP synthase subunit B
 
Yersinia pestis KIM

Gene: y4135: ATP synthase subunit B
 
Serratia proteamaculans 568

Gene: Spro_0008: ATP synthase subunit B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4512: ATP synthase subunit B
 
Edwardsiella tarda EIB202

Gene: ETAE_3533: ATP synthase subunit B
 
Proteus mirabilis HI4320

Gene: PMI3064: ATP synthase subunit B
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0040: ATP synthase subunit B
ATP synthase subunit B
atpC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3731: ATP synthase epsilon subunit
 
Salmonella typhimurium LT2

Gene: STM3864: ATP synthase epsilon subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00069: ATP synthase epsilon subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04136: ATP synthase epsilon subunit
 
Enterobacter sp. 638

Gene: Ent638_4133: ATP synthase epsilon subunit
 
Erwinia amylovora ATCC 49946

Gene: EAM_3473: ATP synthase epsilon subunit
 
Yersinia pestis KIM

Gene: y4134: ATP synthase epsilon subunit
 
Serratia proteamaculans 568

Gene: Spro_0009: ATP synthase epsilon subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4511: ATP synthase epsilon subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_3534: ATP synthase epsilon subunit
 
Proteus mirabilis HI4320

Gene: PMI3065: ATP synthase epsilon subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0039: ATP synthase epsilon subunit
ATP synthase epsilon subunit
 
CRON 24.
b1821
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1821: hypothetical protein
*
Salmonella typhimurium LT2

Site:
position = -276
score = 3.6685
sequence = AATTGTTATTTAATTTAACGTT

Gene: STM1834: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01156: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02337: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_2390: hypothetical protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_3371: hypothetical protein
 
Yersinia pestis KIM

Gene: y2555: hypothetical protein
 
Serratia proteamaculans 568

Gene: Spro_2817: hypothetical protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -267
score = 3.7709
sequence = TAGTGTTGTTTGCATCATAAAT

Gene: ECA2389: hypothetical protein
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -272
score = 3.83152
sequence = AATTATTATCAATATCATCTTT

Site:
position = -237
score = 3.88188
sequence = TAATATGTTGCCTTTCATAAAT

Gene: PMI1608: hypothetical protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -281
score = 3.90643
sequence = TATTGTGCTATCTTTTAAATTG

Site:
position = -179
score = 3.73564
sequence = AAACGTGGTGCGGGTAACCTTA

Gene: plu2701: hypothetical protein
hypothetical protein
 
CRON 25.
b1963
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -287
score = 4.64779
sequence = TGGTGTGATCAGGCGCACATTA

Gene: b1963: orf, hypothetical protein
*
Salmonella typhimurium LT2

Site:
position = -70
score = 5.53769
sequence = AAATGTGATTAATATCACATTA

Site:
position = -34
score = 4.36229
sequence = TCATATGACTTACATCACAAAA

Gene: STM1994: orf, hypothetical protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
orf, hypothetical protein
yedJ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1962: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM1993: hypothetical protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -168
score = 3.81137
sequence = TTTTGTGAATGTTTTATCGTAA

Gene: CKO_00980: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02429: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_2552: hypothetical protein
*
Erwinia amylovora ATCC 49946

Site:
position = -129
score = 3.83761
sequence = TGATGTAATGAGCAACAAATAA

Site:
position = -101
score = 4.37233
sequence = AAGTTTGATGTGGCTAAAATTA

Gene: EAM_2082: hypothetical protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2224: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -156
score = 5.57595
sequence = AAATGTGATGTGAATCACACAA

Gene: plu0518: hypothetical protein
hypothetical protein
 
CRON 26.
b2462
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -103
score = 4.59738
sequence = CTTAGTGATCTACCTCACCTTT

Gene: b2462: putative carboxysome structural protein, ethanol utilization
*
Salmonella typhimurium LT2

Site:
position = -168
score = 3.81256
sequence = AAATGTGATGCACCACGATATT

Site:
position = -103
score = 4.59738
sequence = CTTAGTGATCTACCTCACCTTT

Gene: STM2470: putative carboxysome structural protein, ethanol utilization
*
Citrobacter koseri ATCC BAA-895

Site:
position = -103
score = 4.64369
sequence = CTTAGTGATCTACTTCACCTTT

Gene: CKO_00333: putative carboxysome structural protein, ethanol utilization
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -102
score = 4.32767
sequence = CTGAGTGATCCACTTCACCTTT

Gene: KPN_02796: putative carboxysome structural protein, ethanol utilization
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative carboxysome structural protein, ethanol utilization
eutP
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2461: putative ethanolamine utilization protein
 
Salmonella typhimurium LT2

Gene: STM2469: putative ethanolamine utilization protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00334: putative ethanolamine utilization protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02795: putative ethanolamine utilization protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative ethanolamine utilization protein
eutQ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2460: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM2468: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00335: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02794: hypothetical protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
eutT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2459: predicted cobalamin adenosyltransferase in ethanolamine utilization
 
Salmonella typhimurium LT2

Gene: STM2467: predicted cobalamin adenosyltransferase in ethanolamine utilization
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00336: predicted cobalamin adenosyltransferase in ethanolamine utilization
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02793: predicted cobalamin adenosyltransferase in ethanolamine utilization
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted cobalamin adenosyltransferase in ethanolamine utilization
eutI
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2458: predicted phosphotransacetylase subunit
 
Salmonella typhimurium LT2

Gene: STM2466: predicted phosphotransacetylase subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00337: predicted phosphotransacetylase subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02792: predicted phosphotransacetylase subunit
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted phosphotransacetylase subunit
cchA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2457: detox protein
 
Salmonella typhimurium LT2

Gene: STM2465: detox protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00338: detox protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02791: detox protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
detox protein
cchB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2456: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM2464: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00339: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02790: hypothetical protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
eutE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2455: ethanolamine utilization protein
 
Salmonella typhimurium LT2

Gene: STM2463: ethanolamine utilization protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00340: ethanolamine utilization protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02789: ethanolamine utilization protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ethanolamine utilization protein
eutJ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2454: ethanolamine utilization protein
 
Salmonella typhimurium LT2

Gene: STM2462: ethanolamine utilization protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00341: ethanolamine utilization protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02788: ethanolamine utilization protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ethanolamine utilization protein
eutG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2453: ethanolamine utilization enzyme
 
Salmonella typhimurium LT2

Gene: STM2461: ethanolamine utilization enzyme
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00342: ethanolamine utilization enzyme
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02787: ethanolamine utilization enzyme
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
ethanolamine utilization enzyme
 
CRON 27.
bax
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -189
score = 4.21494
sequence = TTTTGCGATAACCCCCACATTT

Site:
position = -72
score = 4.35407
sequence = ATTTGAGATTCAACTCTCAAAT

Gene: b3570: hypothetical protein
*
Salmonella typhimurium LT2

Site:
position = -189
score = 4.39865
sequence = ATTTGCGATAAGCACCACATTT

Gene: STM3663: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05027: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03934: hypothetical protein
*
Enterobacter sp. 638

Site:
position = -219
score = 4.19452
sequence = ATGAGTGATCTCGCGCAAAATT

Site:
position = -189
score = 4.0549
sequence = ATCTGCGATATCGCACACAATT

Site:
position = -72
score = 4.33901
sequence = ATTTGAGATTCCGCTCTCAATT

Gene: Ent638_0151: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -233
score = 4.17843
sequence = AAATTTGAGTTAAATAGCATTA

Gene: PMI2667: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0503: hypothetical protein
hypothetical protein
 
CRON 28.
arbG
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -202
score = 3.67969
sequence = AACTGCGAGCATGGTCATATTT

Site:
position = -185
score = 3.62492
sequence = TATTTTTATCAATAGCGCATTG

Gene: b3723: transcriptional antiterminator, BglG
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -154
score = 4.23965
sequence = AGTCGCGATCTTAATCACGTTT

Gene: KPN_02579: transcriptional antiterminator, BglG
*
Enterobacter sp. 638

Site:
position = -153
score = 3.86711
sequence = GATCACGATCTAAATCACATTT

Gene: Ent638_2741: transcriptional antiterminator, BglG
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1869: transcriptional antiterminator, BglG
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
transcriptional antiterminator, BglG
 
CRON 29.
caiT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -278
score = 4.25317
sequence = TATTGTTTTATGGATCACCAAT

Site:
position = -246
score = 3.62488
sequence = AGATGTTATTTTTTACTCACAA

Site:
position = -158
score = 5.21924
sequence = AAATGTGATACCAATCACAGAA

Gene: b0040: L-carnitine/gamma-butyrobetaine antiporter
*
Salmonella typhimurium LT2

Site:
position = -167
score = 4.50351
sequence = AAGTGTGACGAAGATAACAGAA

Gene: STM0074: L-carnitine/gamma-butyrobetaine antiporter
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03343: L-carnitine/gamma-butyrobetaine antiporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2664: L-carnitine/gamma-butyrobetaine antiporter
*
Proteus mirabilis HI4320

Site:
position = -209
score = 4.45015
sequence = TAGTGTGAAGTGAATAACAGAA

Gene: PMI2654: L-carnitine/gamma-butyrobetaine antiporter
 
Photorhabdus luminescens subsp. laumondii TTO1
L-carnitine/gamma-butyrobetaine antiporter
caiA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0039: crotonobetainyl-CoA dehydrogenase
 
Salmonella typhimurium LT2

Gene: STM0073: crotonobetainyl-CoA dehydrogenase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03344: crotonobetainyl-CoA dehydrogenase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2663: crotonobetainyl-CoA dehydrogenase
 
Proteus mirabilis HI4320

Gene: PMI2655: crotonobetainyl-CoA dehydrogenase
 
Photorhabdus luminescens subsp. laumondii TTO1
crotonobetainyl-CoA dehydrogenase
caiB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0038: crotonobetainyl-CoA:carnitine CoA-transferase
 
Salmonella typhimurium LT2

Gene: STM0072: crotonobetainyl-CoA:carnitine CoA-transferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03345: crotonobetainyl-CoA:carnitine CoA-transferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2662: crotonobetainyl-CoA:carnitine CoA-transferase
 
Proteus mirabilis HI4320

Gene: PMI2656: crotonobetainyl-CoA:carnitine CoA-transferase
 
Photorhabdus luminescens subsp. laumondii TTO1
crotonobetainyl-CoA:carnitine CoA-transferase
caiC2
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0037: crotonobetaine/carnitine-CoA ligase
 
Salmonella typhimurium LT2

Gene: STM0071: crotonobetaine/carnitine-CoA ligase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03346: crotonobetaine/carnitine-CoA ligase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2661: crotonobetaine/carnitine-CoA ligase
 
Proteus mirabilis HI4320

Gene: PMI2657: crotonobetaine/carnitine-CoA ligase
 
Photorhabdus luminescens subsp. laumondii TTO1
crotonobetaine/carnitine-CoA ligase
caiD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0036: carnitinyl-CoA dehydratase
 
Salmonella typhimurium LT2

Gene: STM0070: carnitinyl-CoA dehydratase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03347: carnitinyl-CoA dehydratase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2660: carnitinyl-CoA dehydratase
 
Proteus mirabilis HI4320

Gene: PMI2658: carnitinyl-CoA dehydratase
 
Photorhabdus luminescens subsp. laumondii TTO1
carnitinyl-CoA dehydratase
caiE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0035: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0069: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03348: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2659: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 30.
cdd
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -128
score = 4.28527
sequence = ATTTGCGATGCGTCGCGCATTT

Site:
position = -78
score = 5.1303
sequence = TAATGAGATTCAGATCACATAT

Gene: b2143: cytidine deaminase
*
Salmonella typhimurium LT2

Site:
position = -128
score = 4.21159
sequence = ATTTGCGATACGTCGCGCATTT

Site:
position = -78
score = 4.8418
sequence = CAATGAGATTTAGATCACATAT

Gene: STM2183: cytidine deaminase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -128
score = 4.28527
sequence = ATTTGCGATGCGTCGCGCATTT

Site:
position = -78
score = 4.80349
sequence = CAATGAGATTTGGATCACATAT

Gene: CKO_00646: cytidine deaminase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -78
score = 4.41902
sequence = GAATGAGATATTCATCACATAT

Gene: KPN_02584: cytidine deaminase
*
Enterobacter sp. 638

Site:
position = -127
score = 4.20282
sequence = ATTTGCGATGCGTCGCGCAATT

Site:
position = -77
score = 4.87754
sequence = TAATGAGAACTGGATCACATAT

Gene: Ent638_2746: cytidine deaminase
*
Erwinia amylovora ATCC 49946

Site:
position = -124
score = 3.9134
sequence = ACTTGCGATAAGTCTCTCATTT

Site:
position = -104
score = 4.09546
sequence = TTTGGTGATGCATTTCATTTAT

Site:
position = -74
score = 4.67843
sequence = TAGAGCGATTTAGATCACATAT

Gene: EAM_2202: cytidine deaminase
*
Yersinia pestis KIM

Site:
position = -75
score = 5.02502
sequence = TAATGAGATATAAATCACAATT

Gene: y2657: cytidine deaminase
*
Serratia proteamaculans 568

Site:
position = -127
score = 4.11792
sequence = ACTTGCGATACATCTCGCAATT

Site:
position = -77
score = 4.4945
sequence = TAAAGAGATTTACATCACACTT

Gene: Spro_1568: cytidine deaminase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -130
score = 4.62306
sequence = AATTGAGATACATCTCGCATTT

Site:
position = -79
score = 4.47804
sequence = TAAAGAGATTCCGATCACAATT

Gene: ECA2830: cytidine deaminase
*
Edwardsiella tarda EIB202

Site:
position = -76
score = 4.92896
sequence = AAAAGTGATTATTATCACAAAT

Gene: ETAE_1162: cytidine deaminase
*
Proteus mirabilis HI4320

Site:
position = -132
score = 4.37898
sequence = ATTTGAGATGTATCTCCCAATT

Site:
position = -82
score = 5.11283
sequence = AAATATGATTTTAATCACATAT

Gene: PMI0643: cytidine deaminase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -75
score = 4.70399
sequence = CTATATGATATTTATCACATTA

Gene: plu1547: cytidine deaminase
cytidine deaminase
 
CRON 31.
cfa
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -80
score = 3.84417
sequence = TTCTGCGAGATTTCTCACAAAG

Gene: b1661: cyclopropane fatty acyl phospholipid synthase
 
Salmonella typhimurium LT2

Gene: STM1427: cyclopropane fatty acyl phospholipid synthase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -81
score = 4.07729
sequence = TTCCGTGAGATTTCTCACAAAG

Gene: CKO_01676: cyclopropane fatty acyl phospholipid synthase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -230
score = 4.07071
sequence = ATCCGTGAGATTTCTCACAAAG

Gene: KPN_01999: cyclopropane fatty acyl phospholipid synthase
*
Enterobacter sp. 638

Site:
position = -79
score = 3.95523
sequence = TTCCGTGAGACTTCTCACAAAC

Gene: Ent638_1786: cyclopropane fatty acyl phospholipid synthase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2192: cyclopropane fatty acyl phospholipid synthase
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -264
score = 4.17189
sequence = AATTGTGCGCTATGTCTCACTA

Gene: ETAE_1836: cyclopropane fatty acyl phospholipid synthase
 
Proteus mirabilis HI4320

Gene: PMI1402: cyclopropane fatty acyl phospholipid synthase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2608: cyclopropane fatty acyl phospholipid synthase
cyclopropane fatty acyl phospholipid synthase
 
CRON 32.
chbB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -201
score = 3.67998
sequence = AAATGTGAAGAGGGTCATAACC

Gene: b1738: N,N'-diacetylchitobiose-specific PTS system , EIIB component
*
Salmonella typhimurium LT2

Site:
position = -250
score = 3.9185
sequence = TTTTGTGCCTGCCATAACCTTA

Site:
position = -203
score = 3.85514
sequence = AAATGTGAGGGGGGTCATAACG

Gene: STM1312: N,N'-diacetylchitobiose-specific PTS system , EIIB component
*
Citrobacter koseri ATCC BAA-895

Site:
position = -188
score = 4.09114
sequence = AAATGTGAGAGGGGTCATAACA

Gene: CKO_01763: N,N'-diacetylchitobiose-specific PTS system , EIIB component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -129
score = 3.87545
sequence = AATTTTGATTAACCGCGAATTA

Gene: Ent638_1706: N,N'-diacetylchitobiose-specific PTS system , EIIB component
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -214
score = 4.50878
sequence = TTTTGCGATAACCATCACATTG

Gene: y1251: N,N'-diacetylchitobiose-specific PTS system , EIIB component
*
Serratia proteamaculans 568

Site:
position = -177
score = 4.6246
sequence = ATTTGCGAGACAGATCACACTA

Site:
position = -143
score = 3.61214
sequence = AAATGTGAAGAGGGTCAATCAG

Gene: Spro_0834: N,N'-diacetylchitobiose-specific PTS system , EIIB component
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2956: N,N'-diacetylchitobiose-specific PTS system , EIIB component
 
Photorhabdus luminescens subsp. laumondii TTO1
N,N'-diacetylchitobiose-specific PTS system , EIIB component
chbC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1737: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Salmonella typhimurium LT2

Gene: STM1313: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01762: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01231: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Enterobacter sp. 638

Gene: Ent638_1707: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1252: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Serratia proteamaculans 568

Gene: Spro_0835: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2955: N,N'-diacetylchitobiose-specific PTS system , EIIC component
 
Photorhabdus luminescens subsp. laumondii TTO1
N,N'-diacetylchitobiose-specific PTS system , EIIC component
chbA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1736: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Salmonella typhimurium LT2

Gene: STM1314: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01761: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01232: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Enterobacter sp. 638

Gene: Ent638_1708: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1253: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2954: N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
 
Photorhabdus luminescens subsp. laumondii TTO1
N,N'-diacetylchitobiose-specific PTS system transporter subunit IIA
chbR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1735: DNA-binding transcriptional dual regulator
 
Salmonella typhimurium LT2

Gene: STM1315: DNA-binding transcriptional dual regulator
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01760: DNA-binding transcriptional dual regulator
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01233: DNA-binding transcriptional dual regulator
 
Enterobacter sp. 638

Gene: Ent638_1709: DNA-binding transcriptional dual regulator
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1254: DNA-binding transcriptional dual regulator
 
Serratia proteamaculans 568

Gene: Spro_0837: DNA-binding transcriptional dual regulator
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2953: DNA-binding transcriptional dual regulator
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding transcriptional dual regulator
chbF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1734: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Salmonella typhimurium LT2

Gene: STM1316: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01759: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01234: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Enterobacter sp. 638

Gene: Ent638_1710: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0836: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2952: 6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
 
Photorhabdus luminescens subsp. laumondii TTO1
6-phospho-beta-glucosidase (cellobiose-6-phosphate hydrolase)
chbG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1733: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM1317: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01758: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_1711: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1255: hypothetical protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ydjC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01235: hypothetical protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0838: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2951: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 33.
citA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03361: signal transduction histidine kinase regulating citrate/malate metabolism
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -269
score = 4.26912
sequence = TAATGTGAAGCTTCCCAAATTA

Gene: KPN_00054: signal transduction histidine kinase regulating citrate/malate metabolism
*
Enterobacter sp. 638

Site:
position = -292
score = 4.10948
sequence = TTATGTGAGGAACGGCATATTA

Gene: Ent638_3378: signal transduction histidine kinase regulating citrate/malate metabolism
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -272
score = 4.58701
sequence = TGCTGTGATTTTGTTCAAAATA

Gene: Spro_3731: signal transduction histidine kinase regulating citrate/malate metabolism
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -104
score = 3.85418
sequence = AAACGTGTTATTGCTCACAAGT

Gene: ECA2577: signal transduction histidine kinase regulating citrate/malate metabolism
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
signal transduction histidine kinase regulating citrate/malate metabolism
citB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03362: response regulator receiver and unknown domain protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00053: response regulator receiver and unknown domain protein
 
Enterobacter sp. 638

Gene: Ent638_3379: response regulator receiver and unknown domain protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_3732: response regulator receiver and unknown domain protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2578: response regulator receiver and unknown domain protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
response regulator receiver and unknown domain protein
 
CRON 34.
CKO_05006
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -95
score = 4.4346
sequence = CTTCGTGATGGTGATCATAATT

Gene: CKO_05006: Xylose isomerase domain protein TIM barrel
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -106
score = 4.48251
sequence = CTTCGTGATGCCGATCATAAAT

Gene: KPN_03912: Xylose isomerase domain protein TIM barrel
*
Enterobacter sp. 638

Site:
position = -97
score = 4.41954
sequence = CTTCGTGATGGCGATCATAAAT

Gene: Ent638_0170: Xylose isomerase domain protein TIM barrel
 
Erwinia amylovora ATCC 49946

Gene: EAM_3438: Xylose isomerase domain protein TIM barrel
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -110
score = 3.9455
sequence = GTTCGTGACTGCGATCATATTT

Gene: Spro_0060: Xylose isomerase domain protein TIM barrel
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Xylose isomerase domain protein TIM barrel
CKO_05007
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05007: PfkB domain protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03913: PfkB domain protein
 
Enterobacter sp. 638

Gene: Ent638_0169: PfkB domain protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_3439: PfkB domain protein
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0059: PfkB domain protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PfkB domain protein
CKO_05008
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05008: major facilitator superfamily MFS_1
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03914: major facilitator superfamily MFS_1
 
Enterobacter sp. 638

Gene: Ent638_0168: major facilitator superfamily MFS_1
 
Erwinia amylovora ATCC 49946

Gene: EAM_3440: major facilitator superfamily MFS_1
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0058: major facilitator superfamily MFS_1
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
major facilitator superfamily MFS_1
tkrA
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_05009: 2-hydroxyacid dehydrogenase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03915: 2-hydroxyacid dehydrogenase
 
Enterobacter sp. 638

Gene: Ent638_0167: 2-hydroxyacid dehydrogenase
 
Erwinia amylovora ATCC 49946

Gene: EAM_3441: 2-hydroxyacid dehydrogenase
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0057: 2-hydroxyacid dehydrogenase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-hydroxyacid dehydrogenase
 
CRON 35.
lpdA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -224
score = 3.26678
sequence = AATTGTTAACAATTTTGTAAAA

Gene: b0116: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Salmonella typhimurium LT2

Site:
position = -153
score = 3.46255
sequence = GTTTGTGAGGTTATTAGCGAAA

Gene: STM0154: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -95
score = 3.26678
sequence = AATTGTTAACAATTTTGTAAAA

Gene: CKO_03256: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -105
score = 3.26678
sequence = AATTGTTAACAATTTTGTAAAA

Gene: KPN_00120: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Enterobacter sp. 638

Gene: Ent638_0662: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0749: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Yersinia pestis KIM

Site:
position = -253
score = 3.32136
sequence = ATTGGTGATCTTGTTATTACTG

Gene: y0769: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Serratia proteamaculans 568

Site:
position = -246
score = 3.57709
sequence = TATGGTGATGTAATGAAAAAAG

Gene: Spro_4009: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3787: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
Edwardsiella tarda EIB202

Gene: ETAE_0662: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Proteus mirabilis HI4320

Site:
position = -133
score = 3.40504
sequence = GGTTGTGAGATCTGTCATGTTA

Gene: PMI2044: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -131
score = 3.89628
sequence = TGTTGCGAGTTCTGTCACGTTA

Gene: plu3621: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
 
CRON 36.
clpS
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -164
score = 3.96009
sequence = AAATTTGAAGCAGTTAACGCTA

Gene: b0881: ATP-dependent Clp protease adaptor protein
*
Salmonella typhimurium LT2

Site:
position = -164
score = 3.96009
sequence = AAATTTGAAGCAGTTAACGCTA

Site:
position = -104
score = 3.59584
sequence = AGATGTTAGTTATCTATCAATT

Gene: STM0944: ATP-dependent Clp protease adaptor protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -164
score = 3.96009
sequence = AAATTTGAAGCAGTTAACGCTA

Site:
position = -135
score = 4.17764
sequence = TAATGTGACAGATGTCGCGGAT

Gene: CKO_02199: ATP-dependent Clp protease adaptor protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -167
score = 3.96009
sequence = AAATTTGAAGCAGTTAACGCTA

Site:
position = -77
score = 4.31914
sequence = ATTTGTGATGAGCATAACCTCT

Gene: KPN_00914: ATP-dependent Clp protease adaptor protein
*
Enterobacter sp. 638

Site:
position = -161
score = 3.93333
sequence = ATTTTTGAAGCAGTTAACGCTA

Site:
position = -132
score = 3.79092
sequence = GAATGTGACAGATATCGCGGAT

Gene: Ent638_1398: ATP-dependent Clp protease adaptor protein
*
Erwinia amylovora ATCC 49946

Site:
position = -161
score = 3.96009
sequence = AAATTTGAAGCAGTTAACGCTA

Site:
position = -132
score = 4.50465
sequence = TTTTGTGATAGAGGTCGCTATT

Gene: EAM_1320: ATP-dependent Clp protease adaptor protein
 
Yersinia pestis KIM

Gene: y2810: ATP-dependent Clp protease adaptor protein
*
Serratia proteamaculans 568

Site:
position = -176
score = 3.59376
sequence = AAGTTTGAAGCAGGTAACGCTA

Gene: Spro_1673: ATP-dependent Clp protease adaptor protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2657: ATP-dependent Clp protease adaptor protein
*
Edwardsiella tarda EIB202

Site:
position = -164
score = 3.80968
sequence = AAGTTTGAGGCAGTTAACGCAA

Site:
position = -144
score = 3.62804
sequence = AATTGTGCGGCAGTGCGCTTTT

Gene: ETAE_2208: ATP-dependent Clp protease adaptor protein
*
Proteus mirabilis HI4320

Site:
position = -268
score = 3.74415
sequence = TGTCTTTATTTACTTAACATTA

Site:
position = -148
score = 4.06448
sequence = AACTTTGATGTAGCTAACGCTT

Gene: PMI0689: ATP-dependent Clp protease adaptor protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -170
score = 4.34805
sequence = AAGTTTGATATAGATAACGATA

Gene: plu1593: ATP-dependent Clp protease adaptor protein
ATP-dependent Clp protease adaptor protein
clpA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0882: ATP-dependent CLP protease ATP-binding subunit
 
Salmonella typhimurium LT2

Gene: STM0945: ATP-dependent CLP protease ATP-binding subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02198: ATP-dependent CLP protease ATP-binding subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00915: ATP-dependent CLP protease ATP-binding subunit
 
Enterobacter sp. 638

Gene: Ent638_1399: ATP-dependent CLP protease ATP-binding subunit
 
Erwinia amylovora ATCC 49946

Gene: EAM_1321: ATP-dependent CLP protease ATP-binding subunit
 
Yersinia pestis KIM

Gene: y2809: ATP-dependent CLP protease ATP-binding subunit
 
Serratia proteamaculans 568

Gene: Spro_1674: ATP-dependent CLP protease ATP-binding subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2656: ATP-dependent CLP protease ATP-binding subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_2207: ATP-dependent CLP protease ATP-binding subunit
 
Proteus mirabilis HI4320

Gene: PMI0690: ATP-dependent CLP protease ATP-binding subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1594: ATP-dependent CLP protease ATP-binding subunit
ATP-dependent CLP protease ATP-binding subunit
 
CRON 37.
coaE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0103: dephospho-CoA kinase
 
Salmonella typhimurium LT2

Gene: STM0140: dephospho-CoA kinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03273: dephospho-CoA kinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00106: dephospho-CoA kinase
 
Enterobacter sp. 638

Gene: Ent638_0648: dephospho-CoA kinase
*
Erwinia amylovora ATCC 49946

Site:
position = -75
score = 4.35585
sequence = TCGTGTGATCTGCGCCACATTA

Gene: EAM_0727: dephospho-CoA kinase
*
Yersinia pestis KIM

Site:
position = -259
score = 3.78777
sequence = AAATGTGATCGGGCGTAAAACA

Gene: y0757: dephospho-CoA kinase
*
Serratia proteamaculans 568

Site:
position = -158
score = 3.80699
sequence = CAGTGTGACCGCCCGCTCATTT

Gene: Spro_0774: dephospho-CoA kinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3802: dephospho-CoA kinase
*
Edwardsiella tarda EIB202

Site:
position = -272
score = 4.02927
sequence = AAATGTGATCATACAAACGATT

Gene: ETAE_0650: dephospho-CoA kinase
*
Proteus mirabilis HI4320

Site:
position = -80
score = 3.82054
sequence = TCTTGTGATAAAAATCAGTTTA

Gene: PMI2052: dephospho-CoA kinase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3641: dephospho-CoA kinase
dephospho-CoA kinase
yacF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0102: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0139: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03274: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00105: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_0647: hypothetical protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0726: hypothetical protein
 
Yersinia pestis KIM

Gene: y0756: hypothetical protein
 
Serratia proteamaculans 568

Gene: Spro_0773: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3803: hypothetical protein
 
Edwardsiella tarda EIB202

Gene: ETAE_0649: hypothetical protein
 
Proteus mirabilis HI4320

Gene: PMI2053: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3642: hypothetical protein
hypothetical protein
yacG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0101: zinc-binding protein
 
Salmonella typhimurium LT2

Gene: STM0138: zinc-binding protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03275: zinc-binding protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00104: zinc-binding protein
 
Enterobacter sp. 638

Gene: Ent638_0646: zinc-binding protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0725: zinc-binding protein
 
Yersinia pestis KIM

Gene: y0755: zinc-binding protein
 
Serratia proteamaculans 568

Gene: Spro_0772: zinc-binding protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -53
score = 3.85162
sequence = AAACGTGTTAAGTATCAAATAG

Gene: ECA3804: zinc-binding protein
 
Edwardsiella tarda EIB202

Gene: ETAE_0648: zinc-binding protein
 
Proteus mirabilis HI4320

Gene: PMI2054: zinc-binding protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3643: zinc-binding protein
zinc-binding protein
 
CRON 38.
cpdB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -118
score = 3.79221
sequence = AACTGTGATAGTGTCATCATTT

Site:
position = -85
score = 3.79357
sequence = AATTGTGGCATTCTTCACTGTT

Gene: b4213: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Salmonella typhimurium LT2

Site:
position = -145
score = 3.72732
sequence = TTCTGTGAACACTCGCAAAAAA

Gene: STM4403: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -25
score = 4.19973
sequence = TTTTGTGTTTCAGATCTAAAAA

Gene: CKO_03616: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -156
score = 3.75653
sequence = TTGTTTTATTTATATCGCATCA

Site:
position = -87
score = 3.68303
sequence = TTTTCTGGCAAGATTCACATTT

Site:
position = -35
score = 4.15863
sequence = TTCTGTGCTATCGCTCATAAAA

Gene: KPN_04607: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Enterobacter sp. 638

Site:
position = -34
score = 4.01012
sequence = TTTTGTGGCTTGGATCGAAAAA

Gene: Ent638_0392: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
 
Erwinia amylovora ATCC 49946

Gene: EAM_0454: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Yersinia pestis KIM

Site:
position = -148
score = 3.58579
sequence = AACTGTGAGCGTCTACGCGTTA

Site:
position = -116
score = 3.77733
sequence = TTTTCTGCCAAACTTCACACTT

Site:
position = -63
score = 4.43882
sequence = TTTTGCGATACATATCGAATAT

Gene: y0653: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
*
Serratia proteamaculans 568

Site:
position = -95
score = 3.82334
sequence = TTTTCTGCCACACTTCACAGTT

Gene: Spro_0453: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3602: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0045: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3927: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
 
CRON 39.
creA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -81
score = 3.72731
sequence = TATTGAGATTTTGTTCTTAATC

Gene: b4397: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM4587: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03389: hypothetical protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -42
score = 3.76777
sequence = TTTTTTAATAATGGTAACAATA

Gene: KPN_04852: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_0558: hypothetical protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_0639: hypothetical protein
 
Yersinia pestis KIM

Gene: y3722: hypothetical protein
*
Serratia proteamaculans 568

Site:
position = -75
score = 3.76599
sequence = TTCTGTGACCTAAAACATAAAC

Gene: Spro_0680: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3894: hypothetical protein
 
Edwardsiella tarda EIB202

Gene: ETAE_0547: hypothetical protein
 
Proteus mirabilis HI4320

Gene: PMI3718: hypothetical protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -111
score = 3.97015
sequence = CTTTGTGAAATTATTCTAATAA

Gene: plu0561: hypothetical protein
hypothetical protein
creB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4398: DNA-binding response regulator CreB
 
Salmonella typhimurium LT2

Gene: STM4588: DNA-binding response regulator CreB
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04853: DNA-binding response regulator CreB
 
Enterobacter sp. 638

Gene: Ent638_0559: DNA-binding response regulator CreB
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding response regulator CreB
creC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4399: sensory histidine kinase CreC
 
Salmonella typhimurium LT2

Gene: STM4589: sensory histidine kinase CreC
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04854: sensory histidine kinase CreC
 
Enterobacter sp. 638

Gene: Ent638_0560: sensory histidine kinase CreC
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
sensory histidine kinase CreC
creD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4400: tolerance to colicin E2
 
Salmonella typhimurium LT2

Gene: STM4590: tolerance to colicin E2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04855: tolerance to colicin E2
 
Enterobacter sp. 638

Gene: Ent638_0561: tolerance to colicin E2
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
tolerance to colicin E2
 
CRON 40.
cspD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -180
score = 4.00922
sequence = TAGCGTTAACTGCTTCAAATTT

Gene: b0880: cold shock-like protein
*
Salmonella typhimurium LT2

Site:
position = -181
score = 4.00922
sequence = TAGCGTTAACTGCTTCAAATTT

Gene: STM0943: cold shock-like protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -210
score = 3.86863
sequence = ATCCGCGACATCTGTCACATTA

Site:
position = -181
score = 4.00922
sequence = TAGCGTTAACTGCTTCAAATTT

Gene: CKO_02200: cold shock-like protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -270
score = 4.15249
sequence = AGAGGTTATGCTCATCACAAAT

Site:
position = -180
score = 4.00922
sequence = TAGCGTTAACTGCTTCAAATTT

Gene: KPN_00913: cold shock-like protein
*
Enterobacter sp. 638

Site:
position = -209
score = 3.78268
sequence = ATCCGCGATATCTGTCACATTC

Site:
position = -180
score = 3.92677
sequence = TAGCGTTAACTGCTTCAAAAAT

Gene: Ent638_1397: cold shock-like protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1318: cold shock-like protein
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -205
score = 3.96164
sequence = TAGCGTTACCTGCTTCAAACTT

Site:
position = -49
score = 3.85705
sequence = TTCAGTTATTCATCTCACCTAA

Gene: Spro_1672: cold shock-like protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2659: cold shock-like protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2209: cold shock-like protein
*
Proteus mirabilis HI4320

Site:
position = -163
score = 3.84753
sequence = AAGCGTTAGCTACATCAAAGTT

Gene: PMI0688: cold shock-like protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -194
score = 4.55121
sequence = TATCGTTATCTATATCAAACTT

Gene: plu1592: cold shock-like protein
cold shock-like protein
 
CRON 41.
cspE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -114
score = 4.00589
sequence = TAACGCGACTTTTATCACTTTT

Gene: b0623: cold shock protein E
*
Salmonella typhimurium LT2

Site:
position = -114
score = 4.26253
sequence = TAACGCGATATTTATCACTTTT

Gene: STM0629: cold shock protein E
*
Citrobacter koseri ATCC BAA-895

Site:
position = -21
score = 4.26253
sequence = TAACGCGATATTTATCACTTTT

Gene: CKO_02534: cold shock protein E
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00656: cold shock protein E
*
Enterobacter sp. 638

Site:
position = -114
score = 3.78878
sequence = TAACGCGACTTTTGTCACTTTT

Gene: Ent638_1159: cold shock protein E
*
Erwinia amylovora ATCC 49946

Site:
position = -113
score = 3.59776
sequence = AAAAACGATATTTATCACTTTT

Gene: EAM_1116: cold shock protein E
 
Yersinia pestis KIM

Gene: y1166: cold shock protein E
 
Serratia proteamaculans 568

Gene: Spro_1189: cold shock protein E
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -113
score = 3.86274
sequence = TTTAGCGACTTTTATCACTTTT

Gene: ECA1294: cold shock protein E
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0418: cold shock protein E
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1289: cold shock protein E
cold shock protein E
 
CRON 42.
cstA2
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -139
score = 3.70455
sequence = CGGAGTGATCGAGTTAACATTG

Gene: b0598: carbon starvation protein
 
Salmonella typhimurium LT2

Gene: STM0600: carbon starvation protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -134
score = 4.26718
sequence = TGAAGTGATCCAGTTAACAATG

Gene: CKO_02563: carbon starvation protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -138
score = 4.08145
sequence = TTAAGTGATCTCGCTAGCAATG

Gene: KPN_00616: carbon starvation protein
*
Enterobacter sp. 638

Site:
position = -138
score = 4.32622
sequence = TAAAGTGATCCGCTTAACACAG

Gene: Ent638_1130: carbon starvation protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2509: carbon starvation protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
carbon starvation protein
ybdD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4512: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0601: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02562: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00617: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_1131: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2510: hypothetical protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 43.
cycA2
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -198
score = 4.70788
sequence = TTTTGTGAGCTGTTTCGCGTTA

Gene: b4208: D-alanine/D-serine/glycine permease
*
Salmonella typhimurium LT2

Site:
position = -193
score = 5.06375
sequence = TTTTGTGAGCTAATTCGCATTA

Site:
position = -170
score = 3.87385
sequence = CAAAGTGATATAACACTCATTT

Gene: STM4398: D-alanine/D-serine/glycine permease
*
Citrobacter koseri ATCC BAA-895

Site:
position = -199
score = 4.39663
sequence = TTTTGTGAGCTAATTCGCGTTG

Gene: CKO_03624: D-alanine/D-serine/glycine permease
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -192
score = 4.74619
sequence = TTTTGTGAGCTATTTCGCGTTA

Site:
position = -169
score = 3.79374
sequence = ATGAGTGATATAACACTCACTT

Gene: KPN_04601: D-alanine/D-serine/glycine permease
*
Enterobacter sp. 638

Site:
position = -201
score = 4.21385
sequence = TTTTGTGAGCTGTTTTGCATTG

Gene: Ent638_0378: D-alanine/D-serine/glycine permease
 
Erwinia amylovora ATCC 49946

Gene: EAM_1398: D-alanine/D-serine/glycine permease
*
Yersinia pestis KIM

Site:
position = -199
score = 4.54073
sequence = CACTGTGATGTACTTAACAAAA

Site:
position = -118
score = 3.71177
sequence = TAATATTAAATTATTCGCAAAT

Gene: y2447: D-alanine/D-serine/glycine permease
 
Serratia proteamaculans 568

Gene: Spro_1825: D-alanine/D-serine/glycine permease
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2885: D-alanine/D-serine/glycine permease
 2
Edwardsiella tarda EIB202

Gene: ETAE_2299: D-alanine/D-serine/glycine permease

Gene: ETAE_2300: D-alanine/D-serine/glycine permease
*
Proteus mirabilis HI4320

Site:
position = -102
score = 4.3583
sequence = TTCTGAGATTTGTGTCACAATA

Gene: PMI1614: D-alanine/D-serine/glycine permease
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -102
score = 4.57679
sequence = TATAGTAATCTGTGTCACAATA

Gene: plu1965: D-alanine/D-serine/glycine permease
D-alanine/D-serine/glycine permease
 
CRON 44.
cydA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -300
score = 3.62694
sequence = TAAATTGTTCTCGATCAAATTG

Site:
position = -255
score = 3.625
sequence = TAAATTGATCACCGTCGAAAAA

Gene: b0733: cytochrome d terminal oxidase, polypeptide subunit I
*
Salmonella typhimurium LT2

Site:
position = -256
score = 3.72571
sequence = TAAATTGATCGCTGTCGAAAAA

Gene: STM0740: cytochrome d terminal oxidase, polypeptide subunit I
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02410: cytochrome d terminal oxidase, polypeptide subunit I
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -252
score = 3.64742
sequence = TATATTGATCACCGTCGAAAAA

Gene: KPN_00736: cytochrome d terminal oxidase, polypeptide subunit I
 
Enterobacter sp. 638

Gene: Ent638_1230: cytochrome d terminal oxidase, polypeptide subunit I
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3063: cytochrome d terminal oxidase, polypeptide subunit I
*
Serratia proteamaculans 568

Site:
position = -300
score = 3.67893
sequence = AAGTCTAACCCACATCACGTAA

Gene: Spro_1271: cytochrome d terminal oxidase, polypeptide subunit I
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1365: cytochrome d terminal oxidase, polypeptide subunit I
*
Edwardsiella tarda EIB202

Site:
position = -222
score = 3.64631
sequence = TATTGTTATATTTGTTATCTTT

Gene: ETAE_2580: cytochrome d terminal oxidase, polypeptide subunit I
*
Proteus mirabilis HI4320

Site:
position = -247
score = 3.76546
sequence = AAATATGCTGTTACTAACCTAA

Gene: PMI0573: cytochrome d terminal oxidase, polypeptide subunit I
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1449: cytochrome d terminal oxidase, polypeptide subunit I
cytochrome d terminal oxidase, polypeptide subunit I
cydB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0734: cytochrome D ubiquinol oxidase subunit II
 
Salmonella typhimurium LT2

Gene: STM0741: cytochrome D ubiquinol oxidase subunit II
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02409: cytochrome D ubiquinol oxidase subunit II
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00737: cytochrome D ubiquinol oxidase subunit II
 
Enterobacter sp. 638

Gene: Ent638_1231: cytochrome D ubiquinol oxidase subunit II
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3062: cytochrome D ubiquinol oxidase subunit II
 
Serratia proteamaculans 568

Gene: Spro_1272: cytochrome D ubiquinol oxidase subunit II
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1366: cytochrome D ubiquinol oxidase subunit II
 
Edwardsiella tarda EIB202

Gene: ETAE_2579: cytochrome D ubiquinol oxidase subunit II
 
Proteus mirabilis HI4320

Gene: PMI0574: cytochrome D ubiquinol oxidase subunit II
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1450: cytochrome D ubiquinol oxidase subunit II
cytochrome D ubiquinol oxidase subunit II
ybgT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4515: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0742: hypothetical protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02408: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00738: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_1232: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3061: hypothetical protein
 
Serratia proteamaculans 568

Gene: Spro_1273: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1367: hypothetical protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0575: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ybgE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0735: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0743: hypothetical protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00739: hypothetical protein
 
Enterobacter sp. 638

Gene: Ent638_1233: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3060: hypothetical protein
 
Serratia proteamaculans 568

Gene: Spro_1274: hypothetical protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1368: hypothetical protein
 
Edwardsiella tarda EIB202

Gene: ETAE_2578: hypothetical protein
 
Proteus mirabilis HI4320

Gene: PMI0576: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 45.
cyoA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -245
score = 3.81729
sequence = ATAATTGTTTTATTTCACATTG

Gene: b0432: cytochrome o ubiquinol oxidase subunit II
 
Salmonella typhimurium LT2

Gene: STM0443: cytochrome o ubiquinol oxidase subunit II
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02729: cytochrome o ubiquinol oxidase subunit II
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00394: cytochrome o ubiquinol oxidase subunit II
 
Enterobacter sp. 638

Gene: Ent638_0899: cytochrome o ubiquinol oxidase subunit II
*
Erwinia amylovora ATCC 49946

Site:
position = -134
score = 4.01077
sequence = AGTTGTGACAGCGTTTGCAAAA

Gene: EAM_0985: cytochrome o ubiquinol oxidase subunit II
*
Yersinia pestis KIM

Site:
position = -137
score = 4.50157
sequence = ATCTGTGACCCCCTTAACATAA

Gene: y1021: cytochrome o ubiquinol oxidase subunit II
*
Serratia proteamaculans 568

Site:
position = -135
score = 4.19887
sequence = ATCTGTGACCCCCTTAACAGAA

Gene: Spro_1090: cytochrome o ubiquinol oxidase subunit II
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1143: cytochrome o ubiquinol oxidase subunit II
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -194
score = 3.62668
sequence = AAATTATAGTTAATTCACAATA

Site:
position = -147
score = 3.58909
sequence = TTAATTACTTGTGATCACATTA

Site:
position = -141
score = 4.29833
sequence = ACTTGTGATCACATTAACACAA

Gene: PMI0108: cytochrome o ubiquinol oxidase subunit II
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3875: cytochrome o ubiquinol oxidase subunit II
cytochrome o ubiquinol oxidase subunit II
cyoB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0431: cytochrome o ubiquinol oxidase subunit I
 
Salmonella typhimurium LT2

Gene: STM0442: cytochrome o ubiquinol oxidase subunit I
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02730: cytochrome o ubiquinol oxidase subunit I
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00393: cytochrome o ubiquinol oxidase subunit I
 
Enterobacter sp. 638

Gene: Ent638_0898: cytochrome o ubiquinol oxidase subunit I
 
Erwinia amylovora ATCC 49946

Gene: EAM_0984: cytochrome o ubiquinol oxidase subunit I
 
Yersinia pestis KIM

Gene: y1020: cytochrome o ubiquinol oxidase subunit I
 
Serratia proteamaculans 568

Gene: Spro_1089: cytochrome o ubiquinol oxidase subunit I
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1142: cytochrome o ubiquinol oxidase subunit I
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0107: cytochrome o ubiquinol oxidase subunit I
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3876: cytochrome o ubiquinol oxidase subunit I
cytochrome o ubiquinol oxidase subunit I
cyoC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0430: cytochrome o ubiquinol oxidase subunit III
 
Salmonella typhimurium LT2

Gene: STM0441: cytochrome o ubiquinol oxidase subunit III
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02731: cytochrome o ubiquinol oxidase subunit III
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00392: cytochrome o ubiquinol oxidase subunit III
 
Enterobacter sp. 638

Gene: Ent638_0897: cytochrome o ubiquinol oxidase subunit III
 
Erwinia amylovora ATCC 49946

Gene: EAM_0983: cytochrome o ubiquinol oxidase subunit III
 
Yersinia pestis KIM

Gene: y1019: cytochrome o ubiquinol oxidase subunit III
 
Serratia proteamaculans 568

Gene: Spro_1088: cytochrome o ubiquinol oxidase subunit III
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1141: cytochrome o ubiquinol oxidase subunit III
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0106: cytochrome o ubiquinol oxidase subunit III
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3877: cytochrome o ubiquinol oxidase subunit III
cytochrome o ubiquinol oxidase subunit III
cyoD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0429: cytochrome o ubiquinol oxidase subunit IV
 
Salmonella typhimurium LT2

Gene: STM0440: cytochrome o ubiquinol oxidase subunit IV
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02732: cytochrome o ubiquinol oxidase subunit IV
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00391: cytochrome o ubiquinol oxidase subunit IV
 
Enterobacter sp. 638

Gene: Ent638_0896: cytochrome o ubiquinol oxidase subunit IV
 
Erwinia amylovora ATCC 49946

Gene: EAM_0982: cytochrome o ubiquinol oxidase subunit IV
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_1087: cytochrome o ubiquinol oxidase subunit IV
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1140: cytochrome o ubiquinol oxidase subunit IV
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0105A: cytochrome o ubiquinol oxidase subunit IV
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3878: cytochrome o ubiquinol oxidase subunit IV
cytochrome o ubiquinol oxidase subunit IV
cyoE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0428: protoheme IX farnesyltransferase
 
Salmonella typhimurium LT2

Gene: STM0439: protoheme IX farnesyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02733: protoheme IX farnesyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00390: protoheme IX farnesyltransferase
 
Enterobacter sp. 638

Gene: Ent638_0895: protoheme IX farnesyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0981: protoheme IX farnesyltransferase
 
Yersinia pestis KIM

Gene: y1018: protoheme IX farnesyltransferase
 
Serratia proteamaculans 568

Gene: Spro_1086: protoheme IX farnesyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1139: protoheme IX farnesyltransferase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI0105: protoheme IX farnesyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3879: protoheme IX farnesyltransferase
protoheme IX farnesyltransferase
 
CRON 46.
cysQ
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -126
score = 3.58694
sequence = AACAGTGAAGAATGCCACAATT

Gene: b4214: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Salmonella typhimurium LT2

Site:
position = -144
score = 3.89637
sequence = TTTTTTGCGAGTGTTCACAGAA

Gene: STM4404: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -178
score = 4.06249
sequence = TTTTTAGATCTGAAACACAAAA

Gene: CKO_03615: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -178
score = 4.08147
sequence = TTTTATGAGCGATAGCACAGAA

Site:
position = -126
score = 3.71557
sequence = AAATGTGAATCTTGCCAGAAAA

Site:
position = -57
score = 3.925
sequence = TGATGCGATATAAATAAAACAA

Gene: KPN_04608: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Enterobacter sp. 638

Site:
position = -167
score = 3.90076
sequence = TTTTTCGATCCAAGCCACAAAA

Gene: Ent638_0393: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Erwinia amylovora ATCC 49946

Site:
position = -158
score = 4.1735
sequence = AAATGTGACACAGCACGAATAA

Gene: EAM_0455: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
 
Yersinia pestis KIM

Gene: y0654: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Serratia proteamaculans 568

Site:
position = -180
score = 3.67878
sequence = AACTGTGAAGTGTGGCAGAAAA

Gene: Spro_0454: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -258
score = 3.67787
sequence = TAAAGTGATTATCGTCTCTAAA

Gene: ECA3601: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
 
Edwardsiella tarda EIB202

Gene: ETAE_0373: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
 
Proteus mirabilis HI4320

Gene: PMI3385: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4559: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
 
CRON 47.
cytR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -128
score = 3.93079
sequence = AAATTCAATATTCATCACACTT

Gene: b3934: transcriptional repressor
 
Salmonella typhimurium LT2

Gene: STM4094: transcriptional repressor
*
Citrobacter koseri ATCC BAA-895

Site:
position = -129
score = 3.80951
sequence = AAATTAAATATCCATCACACTT

Gene: CKO_03060: transcriptional repressor
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -162
score = 3.63241
sequence = TCTTGCGAGCCGGATCGAAAAA

Site:
position = -143
score = 3.90713
sequence = AAATTTAACAAGCATCACGTTT

Gene: KPN_04229: transcriptional repressor
 
Enterobacter sp. 638

Gene: Ent638_4039: transcriptional repressor
 
Erwinia amylovora ATCC 49946

Gene: EAM_0125: transcriptional repressor
*
Yersinia pestis KIM

Site:
position = -177
score = 3.69928
sequence = TTCTGCGAGCCAGTTCGAAAAA

Site:
position = -135
score = 3.60157
sequence = TTATGCAAATTAGGTAACAAAT

Gene: y0297: transcriptional repressor
 
Serratia proteamaculans 568

Gene: Spro_4790: transcriptional repressor
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4259: transcriptional repressor
*
Edwardsiella tarda EIB202

Site:
position = -258
score = 4.21746
sequence = AAGTGCGATCGGGATCGAAAAA

Site:
position = -175
score = 3.62788
sequence = ATATGTGATCATATACTCATCG

Gene: ETAE_3434: transcriptional repressor
*
Proteus mirabilis HI4320

Site:
position = -207
score = 4.25131
sequence = TTTTGCGAACTACCTCATAAAA

Site:
position = -189
score = 3.87444
sequence = AAAAACGATTGGTATCACACTT

Gene: PMI3218: transcriptional repressor
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -213
score = 4.15422
sequence = ATTTGCGAGCCATATCGAATAA

Site:
position = -195
score = 4.57519
sequence = ATAAATGATTTATATCACACTT

Gene: plu4760: transcriptional repressor
transcriptional repressor
 
CRON 48.
dacD2
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -99
score = 4.34079
sequence = AAATGAGAGGGTAGTCACATTT

Gene: b2010: D-alanyl-D-alanine carboxypeptidase
*
Salmonella typhimurium LT2

Site:
position = -95
score = 4.77701
sequence = AAATGTGCCTTGTGTCACATTT

Gene: STM2062: D-alanyl-D-alanine carboxypeptidase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00774: D-alanyl-D-alanine carboxypeptidase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02468: D-alanyl-D-alanine carboxypeptidase
 
Enterobacter sp. 638

Gene: Ent638_2578: D-alanyl-D-alanine carboxypeptidase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2636: D-alanyl-D-alanine carboxypeptidase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0912: D-alanyl-D-alanine carboxypeptidase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-alanyl-D-alanine carboxypeptidase
 
CRON 49.
dadA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -116
score = 4.6729
sequence = AGATGTGAGCCAGCTCACCATA

Gene: b1189: D-amino acid dehydrogenase small subunit
*
Salmonella typhimurium LT2

Site:
position = -107
score = 4.63724
sequence = ATATGTGAAGCACGTCACCATA

Gene: STM1803: D-amino acid dehydrogenase small subunit
*
Citrobacter koseri ATCC BAA-895

Site:
position = -107
score = 4.49423
sequence = AGATGTGAGGTGCGTCACCATA

Gene: CKO_01193: D-amino acid dehydrogenase small subunit
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -106
score = 4.06456
sequence = TGCTGTGAGTTAAGTCACCATA

Gene: KPN_02309: D-amino acid dehydrogenase small subunit
*
Enterobacter sp. 638

Site:
position = -107
score = 4.30072
sequence = AGGTGTGAGGTAAGTCACCATA

Gene: Ent638_2363: D-amino acid dehydrogenase small subunit
 
Erwinia amylovora ATCC 49946

Gene: EAM_1944: D-amino acid dehydrogenase small subunit
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -113
score = 4.58364
sequence = AATTGTGAATGTTGTCACGTTT

Gene: Spro_2746: D-amino acid dehydrogenase small subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -121
score = 4.74797
sequence = AAATGTGATTTGACTCTAAAAT

Gene: PMI1509: D-amino acid dehydrogenase small subunit
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -114
score = 5.36267
sequence = AATTGTGATCTAAATCATAAAT

Gene: plu2561: D-amino acid dehydrogenase small subunit
D-amino acid dehydrogenase small subunit
dadX
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1190: alanine racemase
 
Salmonella typhimurium LT2

Gene: STM1802: alanine racemase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01194: alanine racemase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02308: alanine racemase
 
Enterobacter sp. 638

Gene: Ent638_2362: alanine racemase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1943: alanine racemase
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2745: alanine racemase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI1508: alanine racemase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2560: alanine racemase
alanine racemase
 
CRON 50.
dctA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -143
score = 4.08482
sequence = TTGTGCGAGCCAGCTCAAACTT

Gene: b3528: C4-dicarboxylate transport protein
*
Salmonella typhimurium LT2

Site:
position = -145
score = 4.08482
sequence = TTGTGCGAGCCAGCTCAAACTT

Gene: STM3614: C4-dicarboxylate transport protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -145
score = 3.97967
sequence = TTGTGCGAGCCAGCTCAAAGTT

Gene: CKO_04970: C4-dicarboxylate transport protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -143
score = 3.87666
sequence = TTGTGCGAGTCAGCTCAAAGAT

Gene: KPN_03878: C4-dicarboxylate transport protein
 
Enterobacter sp. 638

Gene: Ent638_3925: C4-dicarboxylate transport protein
*
Erwinia amylovora ATCC 49946

Site:
position = -134
score = 4.39679
sequence = TGAAGTGATTCAGCTCATAAAA

Gene: EAM_3380: C4-dicarboxylate transport protein
 
Yersinia pestis KIM

Gene: y3836: C4-dicarboxylate transport protein
 
Serratia proteamaculans 568

Gene: Spro_0153: C4-dicarboxylate transport protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -157
score = 3.81975
sequence = TGACGTGATTCAGCTCTTGTTT

Gene: ECA4362: C4-dicarboxylate transport protein
*
Edwardsiella tarda EIB202

Site:
position = -155
score = 3.64542
sequence = TTATGCGTTTCAGCTCATAGAA

Gene: ETAE_3379: C4-dicarboxylate transport protein
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -176
score = 4.86215
sequence = TTATGTGATCTATATCTTAAAA

Gene: plu3205: C4-dicarboxylate transport protein
C4-dicarboxylate transport protein
 
CRON 51.
deaD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3162: ATP-independent RNA helicase
*
Salmonella typhimurium LT2

Site:
position = -154
score = 3.94692
sequence = CTTTTTGATTGCCATCACCTTC

Site:
position = -99
score = 4.44031
sequence = TACTTTGAGCCGGTTCACACTT

Gene: STM3280.S: ATP-independent RNA helicase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -103
score = 3.94692
sequence = CTTTTTGATTGCCATCACCTTC

Site:
position = -48
score = 4.44031
sequence = TACTTTGAGCCGGTTCACACTT

Gene: CKO_04559: ATP-independent RNA helicase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -154
score = 3.80716
sequence = TTTTTTGCTTGCCATCACCTTC

Site:
position = -99
score = 4.44031
sequence = TACTTTGAGCCGGTTCACACAT

Gene: KPN_03570: ATP-independent RNA helicase
*
Enterobacter sp. 638

Site:
position = -154
score = 4.08719
sequence = TCTTATGATTGCCATCACCTTA

Site:
position = -99
score = 4.44031
sequence = TACTTTGAGCCGGTTCACACTT

Gene: Ent638_3599: ATP-independent RNA helicase
*
Erwinia amylovora ATCC 49946

Site:
position = -99
score = 4.81383
sequence = TAATTTGAGCCGGTTCACACTT

Gene: EAM_3065: ATP-independent RNA helicase
*
Yersinia pestis KIM

Site:
position = -96
score = 4.81383
sequence = TAATTTGAGCCGGTTCACACTT

Gene: y0696: ATP-independent RNA helicase
*
Serratia proteamaculans 568

Site:
position = -96
score = 4.81383
sequence = TAATTTGAGCCGGTTCACACTT

Gene: Spro_0495: ATP-independent RNA helicase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -96
score = 4.43618
sequence = CAATTTGAGCCGGTTCACACTT

Gene: ECA0718: ATP-independent RNA helicase
*
Edwardsiella tarda EIB202

Site:
position = -96
score = 4.81383
sequence = TAATTTGAGCCGGTTCACACTT

Gene: ETAE_0411: ATP-independent RNA helicase
*
Proteus mirabilis HI4320

Site:
position = -80
score = 5.04968
sequence = TAATTTGAGCCAGTTCACATTT

Gene: PMI3424: ATP-independent RNA helicase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -95
score = 5.04968
sequence = TAATTTGAGCCAGTTCACATTT

Gene: plu4523: ATP-independent RNA helicase
ATP-independent RNA helicase
 
CRON 52.
deoC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -149
score = 4.6238
sequence = TTATTTGAACCAGATCGCATTA

Site:
position = -96
score = 4.52458
sequence = AATTGTGATGTGTATCGAAGTG

Gene: b4381: 2-deoxyribose-5-phosphate aldolase
*
Salmonella typhimurium LT2

Site:
position = -133
score = 4.87909
sequence = TAATTTGATTCAGATCTCATTA

Site:
position = -80
score = 4.16695
sequence = AACTGTGATGTATATCGAAGTG

Gene: STM4567: 2-deoxyribose-5-phosphate aldolase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -134
score = 4.19038
sequence = TTATTTGAAGTGGATCTCGTTA

Site:
position = -81
score = 4.16695
sequence = AACTGTGATGTATATCGAAGTG

Gene: CKO_03410: 2-deoxyribose-5-phosphate aldolase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -158
score = 5.24195
sequence = ATTTGTGATTTTAATCACGTTA

Site:
position = -105
score = 3.70952
sequence = AACTGTGATGAATGTCGAAGTG

Gene: KPN_04837: 2-deoxyribose-5-phosphate aldolase
*
Enterobacter sp. 638

Site:
position = -151
score = 4.59041
sequence = AAATTTGAAGTGGATCTCATTA

Site:
position = -98
score = 3.70952
sequence = AACTGTGATGAATGTCGAAGTG

Gene: Ent638_0541: 2-deoxyribose-5-phosphate aldolase
*
Erwinia amylovora ATCC 49946

Site:
position = -233
score = 4.6175
sequence = TGATGTGATAATTCTAACATTA

Gene: EAM_0615: 2-deoxyribose-5-phosphate aldolase
*
Yersinia pestis KIM

Site:
position = -169
score = 3.67378
sequence = TGCGGTGAGATGGATCTCAATT

Gene: y3743: 2-deoxyribose-5-phosphate aldolase
*
Serratia proteamaculans 568

Site:
position = -262
score = 4.58868
sequence = ATTTGTGAACGATATCGCGTTA

Site:
position = -240
score = 5.52813
sequence = TTTTGTGATGGTCTTCACATAT

Site:
position = -188
score = 3.84023
sequence = TAGTGTGACTGTGAACGCGAAT

Gene: Spro_0660: 2-deoxyribose-5-phosphate aldolase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -282
score = 4.40706
sequence = AAGTGTGAATGAATGCACAAAA

Gene: ECA0727: 2-deoxyribose-5-phosphate aldolase
 
Edwardsiella tarda EIB202

Gene: ETAE_0486: 2-deoxyribose-5-phosphate aldolase
*
Proteus mirabilis HI4320

Site:
position = -267
score = 4.43561
sequence = ATATGTGAGTTACTTCGCAACT

Site:
position = -135
score = 5.57484
sequence = TTTTGTGATTCTGATCACAATT

Site:
position = -83
score = 4.48713
sequence = TATTGTGACAGAAAGCACATCT

Gene: PMI2416: 2-deoxyribose-5-phosphate aldolase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0520: 2-deoxyribose-5-phosphate aldolase
2-deoxyribose-5-phosphate aldolase
deoA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4382: thymidine phosphorylase
 
Salmonella typhimurium LT2

Gene: STM4568: thymidine phosphorylase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03409: thymidine phosphorylase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04838: thymidine phosphorylase
 
Enterobacter sp. 638

Gene: Ent638_0542: thymidine phosphorylase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0616: thymidine phosphorylase
 
Yersinia pestis KIM

Gene: y3742: thymidine phosphorylase
 
Serratia proteamaculans 568

Gene: Spro_0661: thymidine phosphorylase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0728: thymidine phosphorylase
 
Edwardsiella tarda EIB202

Gene: ETAE_0487: thymidine phosphorylase
 
Proteus mirabilis HI4320

Gene: PMI2415: thymidine phosphorylase
 
Photorhabdus luminescens subsp. laumondii TTO1
thymidine phosphorylase
deoB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4383: phosphopentomutase
 
Salmonella typhimurium LT2

Gene: STM4569: phosphopentomutase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03408: phosphopentomutase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04839: phosphopentomutase
 
Enterobacter sp. 638

Gene: Ent638_0543: phosphopentomutase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0617: phosphopentomutase
 
Yersinia pestis KIM

Gene: y3741: phosphopentomutase
 
Serratia proteamaculans 568

Gene: Spro_0662: phosphopentomutase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0729: phosphopentomutase
 
Edwardsiella tarda EIB202

Gene: ETAE_0488: phosphopentomutase
 
Proteus mirabilis HI4320

Gene: PMI2414: phosphopentomutase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0521: phosphopentomutase
phosphopentomutase
deoD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4384: purine nucleoside phosphorylase
 
Salmonella typhimurium LT2

Gene: STM4570: purine nucleoside phosphorylase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03407: purine nucleoside phosphorylase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04840: purine nucleoside phosphorylase
 
Enterobacter sp. 638

Gene: Ent638_0544: purine nucleoside phosphorylase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0618: purine nucleoside phosphorylase
 
Yersinia pestis KIM

Gene: y3740: purine nucleoside phosphorylase
 
Serratia proteamaculans 568

Gene: Spro_0663: purine nucleoside phosphorylase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0730: purine nucleoside phosphorylase
 
Edwardsiella tarda EIB202

Gene: ETAE_0489: purine nucleoside phosphorylase
 
Proteus mirabilis HI4320

Gene: PMI2413: purine nucleoside phosphorylase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0522: purine nucleoside phosphorylase
purine nucleoside phosphorylase
 
CRON 53.
dgoR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -154
score = 4.18014
sequence = TTTTGTGATCTAAATTGTAGTA

Gene: b4479: GntR domain protein
*
Salmonella typhimurium LT2

Site:
position = -154
score = 4.18014
sequence = TTTTGTGATCTAAATTGTAGTA

Gene: STM3830: GntR domain protein
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -154
score = 4.091
sequence = TTTTGTGATCCAAATTGTAGTA

Gene: KPN_04098: GntR domain protein
*
Enterobacter sp. 638

Site:
position = -154
score = 4.20298
sequence = TTTTGTGATCCAGATTGTAGTA

Gene: Ent638_0006: GntR domain protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -103
score = 4.18014
sequence = TTTTGTGATCTTGATTGTAGTA

Gene: Spro_0041: GntR domain protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -164
score = 4.20298
sequence = TTTTGTGATCCAGATTGTAGTA

Gene: ECA4419: GntR domain protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
GntR domain protein
dgoK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3693: 2-dehydro-3-deoxygalactonokinase
 
Salmonella typhimurium LT2

Gene: STM3829: 2-dehydro-3-deoxygalactonokinase
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04097: 2-dehydro-3-deoxygalactonokinase
 
Enterobacter sp. 638

Gene: Ent638_0007: 2-dehydro-3-deoxygalactonokinase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0042: 2-dehydro-3-deoxygalactonokinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4418: 2-dehydro-3-deoxygalactonokinase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-dehydro-3-deoxygalactonokinase
dgoA2
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4477: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04096: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase
 
Enterobacter sp. 638

Gene: Ent638_0008: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0043: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4417: 2-dehydro-3-deoxy-6-phosphogalactonate aldolase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
2-dehydro-3-deoxy-6-phosphogalactonate aldolase
dgoA1
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4478: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Salmonella typhimurium LT2

Gene: STM3828: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04095: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Enterobacter sp. 638

Gene: Ent638_0009: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0044: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4416: Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
Mandelate racemase/muconate lactonizing enzyme, N-terminal domain protein
dgoT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3691: D-galactonate transport
 
Salmonella typhimurium LT2

Gene: STM3827: D-galactonate transport
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04094: D-galactonate transport
 
Enterobacter sp. 638

Gene: Ent638_0010: D-galactonate transport
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_0045: D-galactonate transport
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4415: D-galactonate transport
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-galactonate transport
 
CRON 54.
dppA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3544: dipeptide ABC transporter, substrate-binding protein
 
Salmonella typhimurium LT2

Gene: STM3630: dipeptide ABC transporter, substrate-binding protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -121
score = 3.79433
sequence = TTATGTGAACGGAATCCCCATC

Gene: CKO_04994: dipeptide ABC transporter, substrate-binding protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -62
score = 4.00634
sequence = ATATGCAAACAACATCACAATT

Gene: KPN_03899: dipeptide ABC transporter, substrate-binding protein
 
Enterobacter sp. 638

Gene: Ent638_0184: dipeptide ABC transporter, substrate-binding protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_3394: dipeptide ABC transporter, substrate-binding protein
 
Yersinia pestis KIM

Gene: y3825: dipeptide ABC transporter, substrate-binding protein
*
Serratia proteamaculans 568

Site:
position = -271
score = 3.78683
sequence = TTGTTTGCTGTTTCTCACAGTC

Gene: Spro_0138: dipeptide ABC transporter, substrate-binding protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4394: dipeptide ABC transporter, substrate-binding protein
 
Edwardsiella tarda EIB202

Gene: ETAE_3394: dipeptide ABC transporter, substrate-binding protein
 
Proteus mirabilis HI4320

Gene: PMI2847: dipeptide ABC transporter, substrate-binding protein
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -223
score = 3.66575
sequence = AAATGTGCGCATTGTCATGTTT

Gene: plu0300: dipeptide ABC transporter, substrate-binding protein
dipeptide ABC transporter, substrate-binding protein
dppB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3543: dipeptide ABC transporter, permease protein
 
Salmonella typhimurium LT2

Gene: STM3629: dipeptide ABC transporter, permease protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04993: dipeptide ABC transporter, permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03898: dipeptide ABC transporter, permease protein
 
Enterobacter sp. 638

Gene: Ent638_0185: dipeptide ABC transporter, permease protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_3393: dipeptide ABC transporter, permease protein
*
Yersinia pestis KIM

Site:
position = -211
score = 3.92758
sequence = AGATGTGAGCCATATAACCTCT

Gene: y3826: dipeptide ABC transporter, permease protein
 
Serratia proteamaculans 568

Gene: Spro_0139: dipeptide ABC transporter, permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4393: dipeptide ABC transporter, permease protein
 
Edwardsiella tarda EIB202

Gene: ETAE_3393: dipeptide ABC transporter, permease protein
 
Proteus mirabilis HI4320

Gene: PMI2846: dipeptide ABC transporter, permease protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0301: dipeptide ABC transporter, permease protein
dipeptide ABC transporter, permease protein
dppC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3542: dipeptide transporter
 
Salmonella typhimurium LT2

Gene: STM3628: dipeptide transporter
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04992: dipeptide transporter
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03897: dipeptide transporter
 
Enterobacter sp. 638

Gene: Ent638_0186: dipeptide transporter
 
Erwinia amylovora ATCC 49946

Gene: EAM_3392: dipeptide transporter
 
Yersinia pestis KIM

Gene: y3828: dipeptide transporter
 
Serratia proteamaculans 568

Gene: Spro_0140: dipeptide transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4392: dipeptide transporter
 
Edwardsiella tarda EIB202

Gene: ETAE_3392: dipeptide transporter
 
Proteus mirabilis HI4320

Gene: PMI2845: dipeptide transporter
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0302: dipeptide transporter
dipeptide transporter
dppD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3541: dipeptide transporter ATP-binding subunit
 
Salmonella typhimurium LT2

Gene: STM3627: dipeptide transporter ATP-binding subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04991: dipeptide transporter ATP-binding subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03896: dipeptide transporter ATP-binding subunit
 
Enterobacter sp. 638

Gene: Ent638_0187: dipeptide transporter ATP-binding subunit
 
Erwinia amylovora ATCC 49946

Gene: EAM_3391: dipeptide transporter ATP-binding subunit
 
Yersinia pestis KIM

Gene: y3829: dipeptide transporter ATP-binding subunit
 
Serratia proteamaculans 568

Gene: Spro_0141: dipeptide transporter ATP-binding subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4391: dipeptide transporter ATP-binding subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_3391: dipeptide transporter ATP-binding subunit
 
Proteus mirabilis HI4320

Gene: PMI2844: dipeptide transporter ATP-binding subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0303: dipeptide transporter ATP-binding subunit
dipeptide transporter ATP-binding subunit
dppF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3540: dipeptide transporter ATP-binding subunit
 
Salmonella typhimurium LT2

Gene: STM3626: dipeptide transporter ATP-binding subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04990: dipeptide transporter ATP-binding subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03895: dipeptide transporter ATP-binding subunit
 
Enterobacter sp. 638

Gene: Ent638_0188: dipeptide transporter ATP-binding subunit
 
Erwinia amylovora ATCC 49946

Gene: EAM_3390: dipeptide transporter ATP-binding subunit
 
Yersinia pestis KIM

Gene: y3830: dipeptide transporter ATP-binding subunit
 
Serratia proteamaculans 568

Gene: Spro_0142: dipeptide transporter ATP-binding subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4390: dipeptide transporter ATP-binding subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_3390: dipeptide transporter ATP-binding subunit
 
Proteus mirabilis HI4320

Gene: PMI2843: dipeptide transporter ATP-binding subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0304: dipeptide transporter ATP-binding subunit
dipeptide transporter ATP-binding subunit
 
CRON 55.
acnB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -144
score = 3.47315
sequence = TTTTGTAAACAGATTAACACCT

Gene: b0118: Aconitate hydratase 2 (EC 4.2.1.3)
*
Salmonella typhimurium LT2

Site:
position = -157
score = 3.94267
sequence = TTTTGTAAACAGATTAACACTT

Gene: STM0158: Aconitate hydratase 2 (EC 4.2.1.3)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03252: Aconitate hydratase 2 (EC 4.2.1.3)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -260
score = 3.47315
sequence = TTTTGTAAACAGATTAACACCT

Gene: KPN_00124: Aconitate hydratase 2 (EC 4.2.1.3)
 
Enterobacter sp. 638

Gene: Ent638_0665: Aconitate hydratase 2 (EC 4.2.1.3)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0772: Aconitate hydratase 2 (EC 4.2.1.3)
*
Yersinia pestis KIM

Site:
position = -276
score = 4.26119
sequence = TTATGTGAACGAATTAACACTG

Gene: y0771: Aconitate hydratase 2 (EC 4.2.1.3)
*
Serratia proteamaculans 568

Site:
position = -192
score = 3.87385
sequence = TTATGTGAACGAATTAACAACC

Gene: Spro_4008: Aconitate hydratase 2 (EC 4.2.1.3)
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -163
score = 4.34337
sequence = TTATGTGAACGAATTAACAATC

Gene: ECA3778: Aconitate hydratase 2 (EC 4.2.1.3)
 
Edwardsiella tarda EIB202

Gene: ETAE_0665: Aconitate hydratase 2 (EC 4.2.1.3)
*
Proteus mirabilis HI4320

Site:
position = -177
score = 4.45874
sequence = TTATGTGAACGAATTAACATAG

Gene: PMI2040: Aconitate hydratase 2 (EC 4.2.1.3)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -261
score = 3.6157
sequence = TTCTGTGAACGAATTAACATCG

Gene: plu3619: Aconitate hydratase 2 (EC 4.2.1.3)
Aconitate hydratase 2 (EC 4.2.1.3)
 
CRON 56.
dsdC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -115
score = 3.94899
sequence = TGGAGTGATTTACATCTAAAAA

Site:
position = -85
score = 4.5606
sequence = AATTGAGATATGGTTCACTTTA

Gene: b2364: DNA-binding transcriptional dual regulator
*
Salmonella typhimurium LT2

Site:
position = -142
score = 3.77175
sequence = TGATGTAAATTGAATCAACTAT

Site:
position = -124
score = 4.45035
sequence = CTATGTGATTTCCATCTAATAT

Site:
position = -94
score = 4.17731
sequence = TTTTGCGATATGGTTCATTTTA

Gene: STM3800: DNA-binding transcriptional dual regulator
*
Citrobacter koseri ATCC BAA-895

Site:
position = -32
score = 3.92804
sequence = AAGGGTGATTTGCATCCAATAA

Gene: CKO_00019: DNA-binding transcriptional dual regulator
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -125
score = 3.93954
sequence = AAAGGTGATTTAGCTCTAAAAG

Site:
position = -95
score = 4.18607
sequence = AAATATGCTATGGGTCAAATTA

Gene: KPN_04079: DNA-binding transcriptional dual regulator
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*2
Serratia proteamaculans 568

Site:
position = -76
score = 3.63722
sequence = TTTAGCGACATGGGTCAACTTT

Gene: Spro_2451: DNA-binding transcriptional dual regulator

Gene: Spro_3394: DNA-binding transcriptional dual regulator
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0845: DNA-binding transcriptional dual regulator
*
Proteus mirabilis HI4320

Site:
position = -199
score = 3.58517
sequence = TATTGTTAAACATATTGAATAT

Site:
position = -117
score = 4.35336
sequence = ATAGGTGATCAGATGCACAAAT

Gene: PMI0184: DNA-binding transcriptional dual regulator
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -124
score = 4.37164
sequence = TTCAGTGATACCGATCAAAATT

Site:
position = -94
score = 4.51676
sequence = ATTTGCGATTTAAATCACTAAA

Gene: plu1968: DNA-binding transcriptional dual regulator
DNA-binding transcriptional dual regulator
 
CRON 57.
dsdX
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -154
score = 4.44818
sequence = TAAAGTGAACCATATCTCAATT

Gene: b2365: DsdX permease
*
Salmonella typhimurium LT2

Site:
position = -153
score = 3.97541
sequence = TAAAATGAACCATATCGCAAAA

Site:
position = -123
score = 4.19356
sequence = ATATTAGATGGAAATCACATAG

Gene: STM3801: DsdX permease
*
Citrobacter koseri ATCC BAA-895

Site:
position = -124
score = 3.96497
sequence = TTATTGGATGCAAATCACCCTT

Gene: CKO_00020: DsdX permease
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -152
score = 4.25162
sequence = TAATTTGACCCATAGCATATTT

Site:
position = -122
score = 3.65451
sequence = CTTTTAGAGCTAAATCACCTTT

Gene: KPN_04080: DsdX permease
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2450: DsdX permease
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0847: DsdX permease
*
Proteus mirabilis HI4320

Site:
position = -126
score = 4.36924
sequence = ATTTGTGCATCTGATCACCTAT

Site:
position = -44
score = 3.58303
sequence = ATATTCAATATGTTTAACAATA

Gene: PMI0186: DsdX permease
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -169
score = 4.87179
sequence = TTTAGTGATTTAAATCGCAAAT

Site:
position = -139
score = 4.41609
sequence = AATTTTGATCGGTATCACTGAA

Gene: plu1969: DsdX permease
DsdX permease
dsdA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2366: D-serine dehydratase
 
Salmonella typhimurium LT2

Gene: STM3802: D-serine dehydratase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00021: D-serine dehydratase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04081: D-serine dehydratase
 
Enterobacter sp. 638

Gene: Ent638_0021: D-serine dehydratase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -123
score = 3.65029
sequence = TAAATTGACGAGCATCATCTTT

Gene: Spro_2515: D-serine dehydratase
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0848: D-serine dehydratase
 
Proteus mirabilis HI4320

Gene: PMI0187: D-serine dehydratase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1970: D-serine dehydratase
D-serine dehydratase
 
CRON 58.
dusB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -297
score = 4.41229
sequence = AAGTGCGAGCAAGCTCACAAAA

Site:
position = -212
score = 4.25675
sequence = AATTGAGAACTTACTCAAATTT

Gene: b3260: tRNA-dihydrouridine synthase B
 
Salmonella typhimurium LT2

Gene: STM3384: tRNA-dihydrouridine synthase B
*
Citrobacter koseri ATCC BAA-895

Site:
position = -212
score = 3.69234
sequence = AAATGAGAAGTTACGCAAAATT

Gene: CKO_04672: tRNA-dihydrouridine synthase B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03669: tRNA-dihydrouridine synthase B
*
Enterobacter sp. 638

Site:
position = -299
score = 4.11877
sequence = AAATGGGACCCAGATCGCAAAG

Gene: Ent638_3699: tRNA-dihydrouridine synthase B
*
Erwinia amylovora ATCC 49946

Site:
position = -219
score = 4.02584
sequence = TATTGTTAACTTGCTCACAAGA

Gene: EAM_3146: tRNA-dihydrouridine synthase B
*
Yersinia pestis KIM

Site:
position = -57
score = 4.28211
sequence = TAACGTGATGTTATTTATAATT

Gene: y0213: tRNA-dihydrouridine synthase B
 
Serratia proteamaculans 568

Gene: Spro_4423: tRNA-dihydrouridine synthase B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0256: tRNA-dihydrouridine synthase B
 
Edwardsiella tarda EIB202

Gene: ETAE_3151: tRNA-dihydrouridine synthase B
*
Proteus mirabilis HI4320

Site:
position = -94
score = 3.75596
sequence = TTTCGCGATTTGGTTAAACTTT

Gene: PMI3623: tRNA-dihydrouridine synthase B
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -191
score = 3.65372
sequence = CTAAGTGATAAACTTTACCAAT

Gene: plu4088: tRNA-dihydrouridine synthase B
tRNA-dihydrouridine synthase B
fis
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3261: DNA-binding protein Fis
 
Salmonella typhimurium LT2

Gene: STM3385: DNA-binding protein Fis
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04673: DNA-binding protein Fis
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03670: DNA-binding protein Fis
 
Enterobacter sp. 638

Gene: Ent638_3700: DNA-binding protein Fis
 
Erwinia amylovora ATCC 49946

Gene: EAM_3147: DNA-binding protein Fis
 
Yersinia pestis KIM

Gene: y0214: DNA-binding protein Fis
 
Serratia proteamaculans 568

Gene: Spro_4424: DNA-binding protein Fis
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0255: DNA-binding protein Fis
 
Edwardsiella tarda EIB202

Gene: ETAE_3152: DNA-binding protein Fis
 
Proteus mirabilis HI4320

Gene: PMI3622: DNA-binding protein Fis
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4089: DNA-binding protein Fis
DNA-binding protein Fis
 
CRON 59.
epd
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -213
score = 4.72723
sequence = AAGTGTGATGTGAGTCAGATAA

Gene: b2927: D-erythrose 4-phosphate dehydrogenase
*
Salmonella typhimurium LT2

Site:
position = -213
score = 4.99283
sequence = AAATGTGATGCAGGTCAGATAA

Gene: STM3070: D-erythrose 4-phosphate dehydrogenase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -213
score = 4.78838
sequence = AAGTGTGATGCAGGTCAGATAA

Gene: CKO_04297: D-erythrose 4-phosphate dehydrogenase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -213
score = 4.7998
sequence = AAATGTGATGTGAGTCATATAG

Gene: KPN_03356: D-erythrose 4-phosphate dehydrogenase
*
Enterobacter sp. 638

Site:
position = -215
score = 4.49232
sequence = AAATGTGACGCAAGTCATATAG

Gene: Ent638_3340: D-erythrose 4-phosphate dehydrogenase
*
Erwinia amylovora ATCC 49946

Site:
position = -208
score = 4.06527
sequence = TTTTGTGACGCAGATCGAAAGT

Gene: EAM_2813: D-erythrose 4-phosphate dehydrogenase
*
Yersinia pestis KIM

Site:
position = -216
score = 3.67731
sequence = AATTGTGCCCTTTTTCAGGGAA

Gene: y3309: D-erythrose 4-phosphate dehydrogenase
 
Serratia proteamaculans 568

Gene: Spro_3946: D-erythrose 4-phosphate dehydrogenase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -194
score = 4.07719
sequence = TTTTATGACGCAGGTCACTCTT

Gene: ECA3913: D-erythrose 4-phosphate dehydrogenase
*
Edwardsiella tarda EIB202

Site:
position = -233
score = 4.93067
sequence = AATTGTGATGCAATGCACGTTT

Gene: ETAE_2958: D-erythrose 4-phosphate dehydrogenase
*
Proteus mirabilis HI4320

Site:
position = -253
score = 4.39053
sequence = AAATGTTAACAAGAGCACATTT

Gene: PMI0241: D-erythrose 4-phosphate dehydrogenase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0955: D-erythrose 4-phosphate dehydrogenase
D-erythrose 4-phosphate dehydrogenase
pgk
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2926: phosphoglycerate kinase
 
Salmonella typhimurium LT2

Gene: STM3069: phosphoglycerate kinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04296: phosphoglycerate kinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03355: phosphoglycerate kinase
 
Enterobacter sp. 638

Gene: Ent638_3339: phosphoglycerate kinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2812: phosphoglycerate kinase
 
Yersinia pestis KIM

Gene: y3308: phosphoglycerate kinase
 
Serratia proteamaculans 568

Gene: Spro_3945: phosphoglycerate kinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3912: phosphoglycerate kinase
 
Edwardsiella tarda EIB202

Gene: ETAE_2957: phosphoglycerate kinase
 
Proteus mirabilis HI4320

Gene: PMI0242: phosphoglycerate kinase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0956: phosphoglycerate kinase
phosphoglycerate kinase
 
CRON 60.
CKO_01286
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -122
score = 3.73191
sequence = TTTTTTGATCAAAATCAGCATC

Site:
position = -66
score = 4.35691
sequence = AAATGTGAACAACATCACGCAG

Gene: CKO_01286: hypothetical protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -125
score = 3.73191
sequence = TTTTTTGATCAAAATCAGCATC

Site:
position = -88
score = 3.66716
sequence = TGGTGTGATGCACAGAGCAAAG

Site:
position = -69
score = 3.73489
sequence = AAGTGTGAACAATATCACGCGA

Gene: KPN_02226: hypothetical protein
*
Enterobacter sp. 638

Site:
position = -125
score = 3.73191
sequence = TTTTTTGATCAAAATCAGCATC

Site:
position = -69
score = 4.34642
sequence = AATTGTGAACAACATCACGCTC

Gene: Ent638_2329: hypothetical protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -58
score = 4.33389
sequence = TAGATTGATCTAAATCACAATC

Gene: ECA2434: hypothetical protein
*
Edwardsiella tarda EIB202

Site:
position = -70
score = 5.02125
sequence = TTATGTGAGTGCTATCACAATA

Gene: ETAE_1900: hypothetical protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 61.
fadB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3846: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Salmonella typhimurium LT2

Gene: STM3983: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00188: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04340: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Enterobacter sp. 638

Gene: Ent638_3949: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
*
Erwinia amylovora ATCC 49946

Site:
position = -164
score = 3.59915
sequence = AATTGTTATCATCTTATCACAG

Site:
position = -116
score = 4.03534
sequence = AGTTGTGAACCTGCCCGCAAAT

Gene: EAM_0213: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
*
Yersinia pestis KIM

Site:
position = -149
score = 3.85625
sequence = AAATATGATAAAGATCAATTAG

Site:
position = -116
score = 3.6776
sequence = GATTGTGATCTTCACTGCAAAA

Gene: y0464: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Serratia proteamaculans 568

Gene: Spro_0261: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0208: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -109
score = 4.09592
sequence = CATTGTGATCAGCCCTACATTT

Gene: PMI3550: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -133
score = 3.79175
sequence = CAGTGAGATACAAATCTCACTT

Site:
position = -115
score = 3.91944
sequence = ACTTGTGATCACCCTTGCAAAA

Gene: plu4402: 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase
 
CRON 62.
fadD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -131
score = 3.73551
sequence = AATAGTGACGCGCTTCGCAACC

Gene: b1805: long-chain-fatty-acid--CoA ligase
*
Salmonella typhimurium LT2

Site:
position = -131
score = 3.73551
sequence = AATAGTGACGCGCTTCGCAACC

Gene: STM1818: long-chain-fatty-acid--CoA ligase
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -97
score = 3.73551
sequence = AATAGTGACGCGCTTCGCAACC

Gene: KPN_02322: long-chain-fatty-acid--CoA ligase
 
Enterobacter sp. 638

Gene: Ent638_2375: long-chain-fatty-acid--CoA ligase
*
Erwinia amylovora ATCC 49946

Site:
position = -130
score = 3.94955
sequence = TTTAGTGATGCGCTTCGCAACC

Gene: EAM_1956: long-chain-fatty-acid--CoA ligase
*
Yersinia pestis KIM

Site:
position = -80
score = 4.08985
sequence = AATAGTGATGTATATCTCAACC

Gene: y2236: long-chain-fatty-acid--CoA ligase
*
Serratia proteamaculans 568

Site:
position = -99
score = 3.86902
sequence = ATTAGTGACGTACATCGCAACC

Gene: Spro_2760: long-chain-fatty-acid--CoA ligase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -132
score = 3.80185
sequence = ATTAGTGATCGTTCTCGCAACC

Site:
position = -75
score = 3.67064
sequence = TAAAATAATGTTAATAACAATA

Gene: ECA2372: long-chain-fatty-acid--CoA ligase
 
Edwardsiella tarda EIB202

Gene: ETAE_1459: long-chain-fatty-acid--CoA ligase
*
Proteus mirabilis HI4320

Site:
position = -121
score = 4.36769
sequence = TTTAGTGATACACTTCGCATCT

Gene: PMI1166: long-chain-fatty-acid--CoA ligase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -288
score = 3.79365
sequence = AAATGCTATCTTAAGCAAAAAA

Site:
position = -137
score = 4.00237
sequence = ATTAGTGATGTGTATCTCAACC

Gene: plu2134: long-chain-fatty-acid--CoA ligase
long-chain-fatty-acid--CoA ligase
rnd
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1804: ribonuclease D
 
Salmonella typhimurium LT2

Gene: STM1817: ribonuclease D
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01177: ribonuclease D
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02321: ribonuclease D
 
Enterobacter sp. 638

Gene: Ent638_2374: ribonuclease D
 
Erwinia amylovora ATCC 49946

Gene: EAM_1955: ribonuclease D
*
Yersinia pestis KIM

Site:
position = -73
score = 3.68716
sequence = TGTTGTGTTTGTTATCGAACTA

Gene: y2235: ribonuclease D
 
Serratia proteamaculans 568

Gene: Spro_2759: ribonuclease D
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2371: ribonuclease D
 
Edwardsiella tarda EIB202

Gene: ETAE_1460: ribonuclease D
 
Proteus mirabilis HI4320

Gene: PMI1167: ribonuclease D
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2135: ribonuclease D
ribonuclease D
 
CRON 63.
fadH
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -112
score = 3.87828
sequence = CTTTTTGAATCCCATCACAAAC

Gene: b3081: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Salmonella typhimurium LT2

Site:
position = -113
score = 4.25593
sequence = TTTTTTGAATCCCATCACAATC

Gene: STM3219: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Citrobacter koseri ATCC BAA-895

Site:
position = -113
score = 4.25593
sequence = TTTTTTGAATCCCATCACAATC

Gene: CKO_04487: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -111
score = 3.85999
sequence = TTCTTTGAATCCCATCACAATC

Gene: KPN_03510: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Enterobacter sp. 638

Site:
position = -111
score = 3.93585
sequence = ATCTTTGAATCCCATCACATTC

Gene: Ent638_3539: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Erwinia amylovora ATCC 49946

Site:
position = -169
score = 3.75693
sequence = AACCGTGACTGAGATCGCTAAA

Gene: EAM_0507: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Yersinia pestis KIM

Site:
position = -131
score = 3.99592
sequence = ATTCATGACGGCTATCACAATC

Gene: y3589: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Serratia proteamaculans 568

Site:
position = -126
score = 4.15681
sequence = ATTCATGACATCTATCACATTC

Gene: Spro_4309: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0655: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -213
score = 3.79831
sequence = TATTATTATATGATTAAAAAAT

Site:
position = -103
score = 3.80202
sequence = TTCCATGATTAAGATCACAACT

Gene: PMI3702: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -161
score = 4.26894
sequence = TTTCATGACCTTCATCACATTC

Gene: plu3990: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
 
CRON 64.
fadR
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -21
score = 3.8766
sequence = CTGTGTTATGGAAATCTCACTA

Gene: b1187: fatty acid metabolism regulator
*
Salmonella typhimurium LT2

Site:
position = -21
score = 3.83794
sequence = CTGTGTAATGGAAATCTCACTA

Gene: STM1805: fatty acid metabolism regulator
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01189: fatty acid metabolism regulator
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02311: fatty acid metabolism regulator
*
Enterobacter sp. 638

Site:
position = -21
score = 3.83794
sequence = CTGTGTAATGGAAATCTCACTA

Gene: Ent638_2365: fatty acid metabolism regulator
 
Erwinia amylovora ATCC 49946

Gene: EAM_1946: fatty acid metabolism regulator
*
Yersinia pestis KIM

Site:
position = -113
score = 3.83595
sequence = CTTTATGACTGCTTTCACCATT

Gene: y2177: fatty acid metabolism regulator
 
Serratia proteamaculans 568

Gene: Spro_2748: fatty acid metabolism regulator
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2360: fatty acid metabolism regulator
 
Edwardsiella tarda EIB202

Gene: ETAE_1472: fatty acid metabolism regulator
*
Proteus mirabilis HI4320

Site:
position = -111
score = 4.37178
sequence = TTTTATGATGCCATTCACTATT

Site:
position = -84
score = 3.80931
sequence = ATGGTTGAGCTATATCAAAATT

Gene: PMI1510: fatty acid metabolism regulator
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu2562: fatty acid metabolism regulator
fatty acid metabolism regulator
 
CRON 65.
fbp
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -163
score = 3.86568
sequence = TTTTTTAATCTGCCGCTCATTT

Gene: b4232: fructose-1,6-bisphosphatase
 
Salmonella typhimurium LT2

Gene: STM4415: fructose-1,6-bisphosphatase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03598: fructose-1,6-bisphosphatase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -164
score = 3.94341
sequence = TTTTCTTATCCGGGGCACATTT

Gene: KPN_04626: fructose-1,6-bisphosphatase
 
Enterobacter sp. 638

Gene: Ent638_0418: fructose-1,6-bisphosphatase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0464: fructose-1,6-bisphosphatase
 
Yersinia pestis KIM

Gene: y0664: fructose-1,6-bisphosphatase
 
Serratia proteamaculans 568

Gene: Spro_0464: fructose-1,6-bisphosphatase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3927: fructose-1,6-bisphosphatase
*
Edwardsiella tarda EIB202

Site:
position = -150
score = 3.90394
sequence = TGCATTGATTTAGTTCACATTC

Gene: ETAE_0381: fructose-1,6-bisphosphatase
 
Proteus mirabilis HI4320

Gene: PMI3397: fructose-1,6-bisphosphatase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4550: fructose-1,6-bisphosphatase
fructose-1,6-bisphosphatase
 
CRON 66.
fdrA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -213
score = 3.7813
sequence = TTATTTGATAATCCGCTCACTT

Site:
position = -105
score = 4.67137
sequence = CTGTGTGATATTCATCACCTTA

Gene: b0518: membrane protein FdrA
*
Salmonella typhimurium LT2

Site:
position = -120
score = 4.40248
sequence = TGATGTGACGTTAATCACTCTA

Gene: STM0529: membrane protein FdrA
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -191
score = 4.24577
sequence = AACTGTGACTTTAATCACTCTA

Gene: PMI2202: membrane protein FdrA
 
Photorhabdus luminescens subsp. laumondii TTO1
membrane protein FdrA
ylbE
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4572: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0530: hypothetical protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2201: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ylbF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0520: hypothetical protein
 
Salmonella typhimurium LT2

Gene: STM0531: hypothetical protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2200: hypothetical protein
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
ybcF
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0521: carbamate
 
Salmonella typhimurium LT2

Gene: STM0532: carbamate
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2199: carbamate
 
Photorhabdus luminescens subsp. laumondii TTO1
carbamate
 
CRON 67.
fixA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -215
score = 4.11549
sequence = ATTGGTGATCCATAAAACAATA

Site:
position = -158
score = 4.04512
sequence = ATTGGTGAGGAACTTAACAATA

Gene: b0041: electron transfer flavoprotein, beta subunit
*
Salmonella typhimurium LT2

Site:
position = -281
score = 3.81999
sequence = ATTTTTGCTTTATTTATCAATT

Site:
position = -196
score = 3.68351
sequence = AATATTGAAAATTTTCATATTT

Site:
position = -157
score = 3.97015
sequence = ATTGGTGAGGTGCGTAACACTA

Gene: STM0075: electron transfer flavoprotein, beta subunit
*
Citrobacter koseri ATCC BAA-895

Site:
position = -179
score = 4.01394
sequence = ATTGGTGATCCATCAAACAATA

Site:
position = -122
score = 4.35124
sequence = ATTAGTGAGATGCTTAACAATA

Gene: CKO_03341: electron transfer flavoprotein, beta subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -258
score = 3.73506
sequence = ATTGGTGATCTATGTATTATTT

Gene: ETAE_2666: electron transfer flavoprotein, beta subunit
*
Proteus mirabilis HI4320

Site:
position = -216
score = 4.27648
sequence = ATTGTTGATCCAGATAACAATA

Site:
position = -157
score = 4.30109
sequence = ATTGGTGATGTATTTAGCAATA

Site:
position = -98
score = 3.99615
sequence = ATTGGTGATCTAGATTTAATTT

Gene: PMI2653: electron transfer flavoprotein, beta subunit
 
Photorhabdus luminescens subsp. laumondii TTO1
electron transfer flavoprotein, beta subunit
CKO_03340
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03340: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
CKO_03339
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03339: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
fixX
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0044: ferredoxin-like protein
 
Salmonella typhimurium LT2

Gene: STM0078: ferredoxin-like protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03338: ferredoxin-like protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2669: ferredoxin-like protein
 
Proteus mirabilis HI4320

Gene: PMI2650: ferredoxin-like protein
 
Photorhabdus luminescens subsp. laumondii TTO1
ferredoxin-like protein
CKO_03337
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03337: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
fixB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2667: electron transfer flavoprotein, alpha subunit
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
electron transfer flavoprotein, alpha subunit
fixC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2668: oxidoreductase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
oxidoreductase
yaaU
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2670: transport protein
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
transport protein
PMI2649
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0042: predicted electron transfer flavoprotein, NAD/FAD-binding domain and ETFP adenine nucleotide-binding domain-like
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2649: MFS-family transporter
 
Photorhabdus luminescens subsp. laumondii TTO1
MFS-family transporter
fixC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0043: predicted oxidoreductase with FAD/NAD(P)-binding domain
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted oxidoreductase with FAD/NAD(P)-binding domain
yaaU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0045: predicted transporter
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
predicted transporter
fixB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2652: electron transfer flavoprotein alpha subunit for carnitine metabolism
 
Photorhabdus luminescens subsp. laumondii TTO1
electron transfer flavoprotein alpha subunit for carnitine metabolism
fixC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2651: FAD-dependent oxidoreductase subunit for carnitine metabolism
 
Photorhabdus luminescens subsp. laumondii TTO1
FAD-dependent oxidoreductase subunit for carnitine metabolism
fixB
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0076: putative electron transfer flavoprotein, carnitine metabolism
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative electron transfer flavoprotein, carnitine metabolism
fixC
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0077: related to carnitine metabolism
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
related to carnitine metabolism
yaaU
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2

Gene: STM0079: putative MFS family transport protein
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
putative MFS family transport protein
 
CRON 68.
flhD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -280
score = 5.05663
sequence = TTGTGTGATCTGCATCACGCAT

Gene: b1892: DNA-binding transcriptional dual regulator with FlhC
*
Salmonella typhimurium LT2

Site:
position = -285
score = 5.80949
sequence = ATATGTGATCTGCATCACATAT

Gene: STM1925: DNA-binding transcriptional dual regulator with FlhC
*
Citrobacter koseri ATCC BAA-895

Site:
position = -283
score = 5.90069
sequence = TTATGTGATCTGGATCACATAT

Gene: CKO_01056: DNA-binding transcriptional dual regulator with FlhC
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
*
Enterobacter sp. 638

Site:
position = -285
score = 5.54676
sequence = TTTTGTGATCTAGGTCACACTT

Gene: Ent638_2470: DNA-binding transcriptional dual regulator with FlhC
 
Erwinia amylovora ATCC 49946

Gene: EAM_2034: DNA-binding transcriptional dual regulator with FlhC
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2989: DNA-binding transcriptional dual regulator with FlhC
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1685: DNA-binding transcriptional dual regulator with FlhC
*
Edwardsiella tarda EIB202

Site:
position = -122
score = 4.0317
sequence = CGTTATGCTCCATTTCACATTA

Gene: ETAE_1336: DNA-binding transcriptional dual regulator with FlhC
*
Proteus mirabilis HI4320

Site:
position = -158
score = 3.59512
sequence = TGAAATGATCGTAATCAAGTAA

Gene: PMI1672: DNA-binding transcriptional dual regulator with FlhC
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1847: DNA-binding transcriptional dual regulator with FlhC
DNA-binding transcriptional dual regulator with FlhC
flhC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1891: DNA-binding transcriptional dual regulator with FlhD
 
Salmonella typhimurium LT2

Gene: STM1924.S: DNA-binding transcriptional dual regulator with FlhD
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01057: DNA-binding transcriptional dual regulator with FlhD
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638

Gene: Ent638_2469: DNA-binding transcriptional dual regulator with FlhD
 
Erwinia amylovora ATCC 49946

Gene: EAM_2033: DNA-binding transcriptional dual regulator with FlhD
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_2988: DNA-binding transcriptional dual regulator with FlhD
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1686: DNA-binding transcriptional dual regulator with FlhD
 
Edwardsiella tarda EIB202

Gene: ETAE_1337: DNA-binding transcriptional dual regulator with FlhD
 
Proteus mirabilis HI4320

Gene: PMI1671: DNA-binding transcriptional dual regulator with FlhD
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1848: DNA-binding transcriptional dual regulator with FlhD
DNA-binding transcriptional dual regulator with FlhD
 
CRON 69.
focA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -156
score = 3.58236
sequence = TATTTTTATTTGGATAATCAAA

Site:
position = -78
score = 3.79747
sequence = AGATATGATCTATATCAATTTC

Gene: b0904: formate transporter
*
Salmonella typhimurium LT2

Site:
position = -78
score = 4.35014
sequence = AGATATGATCTATATCAAATTC

Gene: STM0974: formate transporter
*
Citrobacter koseri ATCC BAA-895

Site:
position = -198
score = 3.58236
sequence = TATTTTTATTTGGATAATCAAA

Site:
position = -120
score = 4.35014
sequence = AGATATGATCTATATCAAATTC

Gene: CKO_02167: formate transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -121
score = 3.79747
sequence = AGATATGATCTATATCAATTTC

Gene: KPN_00932: formate transporter
*
Enterobacter sp. 638

Site:
position = -78
score = 3.79747
sequence = AGATATGATCTATATCAATTTC

Gene: Ent638_1424: formate transporter
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -84
score = 4.0054
sequence = CAATATGATCCATATCAATTTT

Gene: y2789: formate transporter
 
Serratia proteamaculans 568

Gene: Spro_1703: formate transporter
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -79
score = 4.54556
sequence = CAATATGATCCACATCAAATTT

Gene: ECA2596: formate transporter
 
Edwardsiella tarda EIB202

Gene: ETAE_2181: formate transporter
*
Proteus mirabilis HI4320

Site:
position = -188
score = 4.0072
sequence = TTTTTTGATAAAATTTAAAAAA

Gene: PMI0706: formate transporter
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -88
score = 4.66963
sequence = AATTATGATCTATATCAAATTC

Gene: plu1614: formate transporter
formate transporter
pflB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0903: formate acetyltransferase
 
Salmonella typhimurium LT2

Gene: STM0973: formate acetyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02168: formate acetyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00931: formate acetyltransferase
 
Enterobacter sp. 638

Gene: Ent638_1423: formate acetyltransferase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y2790: formate acetyltransferase
 
Serratia proteamaculans 568

Gene: Spro_1702: formate acetyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2597: formate acetyltransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_2182: formate acetyltransferase
 
Proteus mirabilis HI4320

Gene: PMI0705: formate acetyltransferase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1613: formate acetyltransferase
formate acetyltransferase
 
CRON 70.
folE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -101
score = 3.82935
sequence = TTATGTGCGCCGCCTCACGCAC

Gene: b2153: GTP cyclohydrolase I
*
Salmonella typhimurium LT2

Site:
position = -101
score = 3.9568
sequence = TTATGTGCGCTACCTCACGCAC

Gene: STM2193: GTP cyclohydrolase I
*
Citrobacter koseri ATCC BAA-895

Site:
position = -98
score = 3.82935
sequence = TTATGTGCGCCGCCTCACGCAC

Gene: CKO_00638: GTP cyclohydrolase I
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -84
score = 3.49413
sequence = TTCTGTGCGCCACCTCACGCAC

Gene: KPN_02591: GTP cyclohydrolase I
*
Enterobacter sp. 638

Site:
position = -84
score = 3.86765
sequence = TTATGTGCGCCACCTCACGCAC

Gene: Ent638_2753: GTP cyclohydrolase I
 
Erwinia amylovora ATCC 49946

Gene: EAM_2210: GTP cyclohydrolase I
 
Yersinia pestis KIM

Gene: y2664: GTP cyclohydrolase I
*
Serratia proteamaculans 568

Site:
position = -121
score = 4.34787
sequence = AATCTTGACCGGGTTCACGTTA

Gene: Spro_1560: GTP cyclohydrolase I
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2711: GTP cyclohydrolase I
 
Edwardsiella tarda EIB202

Gene: ETAE_1155: GTP cyclohydrolase I
*
Proteus mirabilis HI4320

Site:
position = -86
score = 4.86165
sequence = TAATGTGATTCAGCTCATCTAA

Gene: PMI0639: GTP cyclohydrolase I
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1543: GTP cyclohydrolase I
GTP cyclohydrolase I
yeiB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2152: conserved inner membrane protein
 
Salmonella typhimurium LT2

Gene: STM2192: conserved inner membrane protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00639: conserved inner membrane protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02590: conserved inner membrane protein
 
Enterobacter sp. 638

Gene: Ent638_2752: conserved inner membrane protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_2209: conserved inner membrane protein
 
Yersinia pestis KIM

Gene: y2663: conserved inner membrane protein
 
Serratia proteamaculans 568

Gene: Spro_1561: conserved inner membrane protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2710: conserved inner membrane protein
 
Edwardsiella tarda EIB202

Gene: ETAE_1156: conserved inner membrane protein
 
Proteus mirabilis HI4320

Gene: PMI0640: conserved inner membrane protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1544: conserved inner membrane protein
conserved inner membrane protein
 
CRON 71.
fruB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -178
score = 4.32993
sequence = AATTGTGCAGCACATCAAACTT

Gene: b2169: PTS system, fructose-specific IIA/FPr component
*
Salmonella typhimurium LT2

Site:
position = -177
score = 4.62552
sequence = AAATGTGCTTCACCTCAAAAAA

Gene: STM2206: PTS system, fructose-specific IIA/FPr component
*
Citrobacter koseri ATCC BAA-895

Site:
position = -50
score = 4.10428
sequence = AAGTGTGCTTTATCTCTAAATT

Gene: CKO_00613: PTS system, fructose-specific IIA/FPr component
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -177
score = 3.53858
sequence = AAGTGTGCAGTACCTCTAAGTT

Gene: KPN_02600: PTS system, fructose-specific IIA/FPr component
*
Enterobacter sp. 638

Site:
position = -178
score = 4.32707
sequence = AAATGTGCTGCACTTCTAAATT

Gene: Ent638_2763: PTS system, fructose-specific IIA/FPr component
*
Erwinia amylovora ATCC 49946

Site:
position = -179
score = 4.4346
sequence = AAATGTGCTGGCTGTCAAAAAT

Gene: EAM_2223: PTS system, fructose-specific IIA/FPr component
*
Yersinia pestis KIM

Site:
position = -178
score = 4.12089
sequence = AAATGTGCGGAATGTCAAAAAT

Gene: y2887: PTS system, fructose-specific IIA/FPr component
*
Serratia proteamaculans 568

Site:
position = -177
score = 4.00306
sequence = AAGTGTGCGTGAGGTCAAAAAT

Gene: Spro_3230: PTS system, fructose-specific IIA/FPr component
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -180
score = 4.13541
sequence = AAATGTGCGTGATGTCAAAATT

Gene: ECA2729: PTS system, fructose-specific IIA/FPr component
*
Edwardsiella tarda EIB202

Site:
position = -199
score = 4.09864
sequence = AAATGTGCTGAAGGTCTAAAAT

Gene: ETAE_2303: PTS system, fructose-specific IIA/FPr component
 
Proteus mirabilis HI4320
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -180
score = 4.65172
sequence = AAATGTGAGTAATCTCAAAAAA

Gene: plu1992: PTS system, fructose-specific IIA/FPr component
PTS system, fructose-specific IIA/FPr component
fruK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2168: 1-phosphofructokinase
 
Salmonella typhimurium LT2

Gene: STM2205: 1-phosphofructokinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00614: 1-phosphofructokinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02599: 1-phosphofructokinase
 
Enterobacter sp. 638

Gene: Ent638_2762: 1-phosphofructokinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2222: 1-phosphofructokinase
 
Yersinia pestis KIM

Gene: y2886: 1-phosphofructokinase
 
Serratia proteamaculans 568

Gene: Spro_3229: 1-phosphofructokinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2728: 1-phosphofructokinase
 
Edwardsiella tarda EIB202

Gene: ETAE_2302: 1-phosphofructokinase
*
Proteus mirabilis HI4320

Site:
position = -254
score = 4.55833
sequence = AAACGTGATTTAGATCTAACTT

Gene: PMI2157: 1-phosphofructokinase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -72
score = 3.65295
sequence = TTTAGTGATATAAATAGAACTG

Gene: plu2858: 1-phosphofructokinase
1-phosphofructokinase
fruA
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2167: PTS system, fructose-specific IIBC component
 
Salmonella typhimurium LT2

Gene: STM2204: PTS system, fructose-specific IIBC component
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00615: PTS system, fructose-specific IIBC component
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02598: PTS system, fructose-specific IIBC component
 
Enterobacter sp. 638

Gene: Ent638_2761: PTS system, fructose-specific IIBC component
 
Erwinia amylovora ATCC 49946

Gene: EAM_2221: PTS system, fructose-specific IIBC component
 
Yersinia pestis KIM

Gene: y2885: PTS system, fructose-specific IIBC component
 
Serratia proteamaculans 568

Gene: Spro_3228: PTS system, fructose-specific IIBC component
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2727: PTS system, fructose-specific IIBC component
 
Edwardsiella tarda EIB202

Gene: ETAE_2301: PTS system, fructose-specific IIBC component
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1993: PTS system, fructose-specific IIBC component
PTS system, fructose-specific IIBC component
 
CRON 72.
frwC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -202
score = 3.95758
sequence = ATTTGCGACGCGTCTCACAAGA

Site:
position = -147
score = 4.30639
sequence = AGTTATGAGGCGGATCGCATTT

Site:
position = -57
score = 3.93421
sequence = TATTGTTTCCTCCATCAAAAAT

Gene: b3949: hypothetical protein
*
Salmonella typhimurium LT2

Site:
position = -221
score = 4.0979
sequence = AAATGTAATGTAGCGCAAAAAG

Site:
position = -202
score = 3.99814
sequence = AAGTGCGAGTTGTCTCACAACT

Site:
position = -147
score = 4.25234
sequence = AGTTATGAAGCGGATCGCATTT

Gene: STM4112: hypothetical protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -202
score = 3.93774
sequence = AATTGCGAGACACTTCACAAGT

Site:
position = -147
score = 4.30639
sequence = AGTTATGAGGCGGATCGCATTT

Gene: CKO_03045: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -258
score = 4.51985
sequence = AATTGGGATATTGCTCACAAAG

Gene: y3777: hypothetical protein
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
frwB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3950: PTS system fructose-like IIB component 1
 
Salmonella typhimurium LT2

Gene: STM4113: PTS system fructose-like IIB component 1
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03044: PTS system fructose-like IIB component 1
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y3778: PTS system fructose-like IIB component 1
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
PTS system fructose-like IIB component 1
 
CRON 73.
fsr
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -65
score = 3.66108
sequence = TAGTCTGGTAATAATCACAAAT

Gene: b0479: fosmidomycin resistance protein
*
Salmonella typhimurium LT2

Site:
position = -100
score = 3.79371
sequence = AATTGAGACTTCCTTCAAACAC

Gene: STM0493: fosmidomycin resistance protein
*
Citrobacter koseri ATCC BAA-895

Site:
position = -102
score = 3.79371
sequence = AATTGAGACTTCCTTCAAACAC

Gene: CKO_02670: fosmidomycin resistance protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -197
score = 3.80148
sequence = AATTGCGACTTCCTTCAAACCT

Gene: KPN_00460: fosmidomycin resistance protein
*
Enterobacter sp. 638

Site:
position = -92
score = 3.96777
sequence = AATTGCGACTTTCCTCAAATCT

Gene: Ent638_0958: fosmidomycin resistance protein
 
Erwinia amylovora ATCC 49946

Gene: EAM_1038: fosmidomycin resistance protein
 
Yersinia pestis KIM

Gene: y1087: fosmidomycin resistance protein
*
Serratia proteamaculans 568

Site:
position = -100
score = 4.65466
sequence = TTTTGCGATGTGCGTCAAATTA

Gene: Spro_1146: fosmidomycin resistance protein
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2455: fosmidomycin resistance protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu3829: fosmidomycin resistance protein
fosmidomycin resistance protein
 
CRON 74.
fucA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -144
score = 4.05309
sequence = TTAGTTGAACCAGGTCACAAAA

Site:
position = -54
score = 3.99662
sequence = TAGTGTGAAAGGAACAACATTA

Gene: b2800: L-fuculose phosphate aldolase
*
Salmonella typhimurium LT2

Site:
position = -157
score = 4.76413
sequence = TTAATTGATGTGAATCACAAAA

Gene: STM2974: L-fuculose phosphate aldolase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -144
score = 4.71486
sequence = TTAATTGATGCGTATCACAAAA

Gene: CKO_04159: L-fuculose phosphate aldolase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -155
score = 4.4222
sequence = ATAATTGACGCGGCTCACAAAA

Gene: KPN_03151: L-fuculose phosphate aldolase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -175
score = 4.21428
sequence = AGTCTTGATGACGGTCACAAAA

Gene: ETAE_0293: L-fuculose phosphate aldolase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-fuculose phosphate aldolase
fucO
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2799: L-1,2-propanediol oxidoreductase
 
Salmonella typhimurium LT2

Gene: STM2973: L-1,2-propanediol oxidoreductase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04157: L-1,2-propanediol oxidoreductase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03150: L-1,2-propanediol oxidoreductase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0294: L-1,2-propanediol oxidoreductase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-1,2-propanediol oxidoreductase
 
CRON 75.
fucP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -207
score = 4.8944
sequence = TAAAGTGATGGTAGTCACATAA

Site:
position = -167
score = 4.46422
sequence = AAGTGTGACCGCCGTCATATTA

Gene: b2801: L-fucose permease
*
Salmonella typhimurium LT2

Site:
position = -207
score = 4.72061
sequence = TAAAGTGATGATAATCACAGAA

Site:
position = -167
score = 4.88579
sequence = AAATGTGACCGCCATCATATTA

Gene: STM2975: L-fucose permease
*
Citrobacter koseri ATCC BAA-895

Site:
position = -219
score = 5.02331
sequence = TAAAGTGATGATAATCACATAA

Site:
position = -179
score = 4.7976
sequence = AAATGTGACCACCATCATATTA

Gene: CKO_04160: L-fucose permease
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -260
score = 4.693
sequence = TAAAGTGACAATAATCACATAA

Site:
position = -220
score = 4.6082
sequence = AAGTGTGACCATCATCATATTA

Gene: KPN_03152: L-fucose permease
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0291: L-fucose permease
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-fucose permease
fucI
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2802: L-fucose isomerase
 
Salmonella typhimurium LT2

Gene: STM2976: L-fucose isomerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04161: L-fucose isomerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03153: L-fucose isomerase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0290: L-fucose isomerase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-fucose isomerase
fucK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2803: L-fuculokinase
 
Salmonella typhimurium LT2

Gene: STM2977: L-fuculokinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04163: L-fuculokinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03154: L-fuculokinase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0289: L-fuculokinase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
L-fuculokinase
fucU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2804: conserved protein of fucose operon
 
Salmonella typhimurium LT2

Gene: STM2978: conserved protein of fucose operon
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03155: conserved protein of fucose operon
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0288: conserved protein of fucose operon
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
conserved protein of fucose operon
fucR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2805: DNA-binding transcriptional activator
 
Salmonella typhimurium LT2

Gene: STM2979: DNA-binding transcriptional activator
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03156: DNA-binding transcriptional activator
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0287: DNA-binding transcriptional activator
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
DNA-binding transcriptional activator
CKO_04162
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04162: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 76.
fxsA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -202
score = 4.11624
sequence = TACCGTAATCTGGATCACTTTA

Site:
position = -152
score = 4.31556
sequence = ATTTGTGAAATAGATCACCGCT

Gene: b4140: suppressor of F plamsid exlusion of phage T7
*
Salmonella typhimurium LT2

Site:
position = -203
score = 4.11624
sequence = TACCGTAATCTGGATCACTTAA

Site:
position = -153
score = 4.10503
sequence = TTTTGTGAAATAGGTCACCGCT

Gene: STM4327: suppressor of F plamsid exlusion of phage T7
*
Citrobacter koseri ATCC BAA-895

Site:
position = -156
score = 4.10503
sequence = TTTTGTGAAATAGGTCACCGCT

Gene: CKO_03695: suppressor of F plamsid exlusion of phage T7
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -140
score = 3.6642
sequence = ATCTGTGAAATGGGTCACCGCT

Gene: KPN_04530: suppressor of F plamsid exlusion of phage T7
*
Enterobacter sp. 638

Site:
position = -151
score = 3.76933
sequence = ATCTGTGAAATGAATCACCGCT

Gene: Ent638_0327: suppressor of F plamsid exlusion of phage T7
*
Erwinia amylovora ATCC 49946

Site:
position = -161
score = 3.89641
sequence = ATATCTGTTCCAGGTCACATTG

Gene: EAM_0417: suppressor of F plamsid exlusion of phage T7
*
Yersinia pestis KIM

Site:
position = -245
score = 4.80552
sequence = ATCTGTGATTGCTCTCACACTT

Gene: y0607: suppressor of F plamsid exlusion of phage T7
*
Serratia proteamaculans 568

Site:
position = -117
score = 4.91377
sequence = TTCTGTGATCTCATTCACGTTT

Gene: Spro_0407: suppressor of F plamsid exlusion of phage T7
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -245
score = 3.73223
sequence = AACTGTGATTGTAGTCACGAGT

Site:
position = -185
score = 3.58919
sequence = AAATGTGCAAAGGCGCACCCAT

Gene: ECA0623: suppressor of F plamsid exlusion of phage T7
*
Edwardsiella tarda EIB202

Site:
position = -189
score = 4.58736
sequence = ATCTGTGATAATACTCACAGAT

Gene: ETAE_0312: suppressor of F plamsid exlusion of phage T7
*
Proteus mirabilis HI4320

Site:
position = -188
score = 4.68071
sequence = TTTTGTGATCTATCTCATGGAT

Gene: PMI2545: suppressor of F plamsid exlusion of phage T7
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -188
score = 5.56287
sequence = ATATGTGATATTTATCACAATT

Gene: plu4136: suppressor of F plamsid exlusion of phage T7
suppressor of F plamsid exlusion of phage T7
 
CRON 77.
galE2
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -78
score = 3.75583
sequence = TAATTTATTCCATGTCACACTT

Gene: b0759: UDP-galactose-4-epimerase
*
Salmonella typhimurium LT2

Site:
position = -78
score = 3.65283
sequence = TAATTTATTACATGTCACACTT

Gene: STM0776: UDP-galactose-4-epimerase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -36
score = 3.6556
sequence = TAATATATTCCATGTCACACTT

Gene: CKO_02376: UDP-galactose-4-epimerase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -78
score = 3.71863
sequence = TAACTTGTGCTATGTCACACTT

Site:
position = -44
score = 4.10731
sequence = ATATGCTATCTTCCTCACAAAC

Gene: KPN_00773: UDP-galactose-4-epimerase
 
Enterobacter sp. 638

Gene: Ent638_1250: UDP-galactose-4-epimerase
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -163
score = 3.69049
sequence = TTATTTGTCTATGCTCACAGAA

Gene: y3043: UDP-galactose-4-epimerase
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -72
score = 3.72321
sequence = ATTCTCGCTGTAGATCACCTTT

Gene: ECA1389: UDP-galactose-4-epimerase
*
Edwardsiella tarda EIB202

Site:
position = -195
score = 3.6704
sequence = TAGTGTAAGCGATACCACAAAC

Gene: ETAE_2564: UDP-galactose-4-epimerase
 
Proteus mirabilis HI4320

Gene: PMI1951: UDP-galactose-4-epimerase
 
Photorhabdus luminescens subsp. laumondii TTO1
UDP-galactose-4-epimerase
galT
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0758: galactose-1-phosphate uridylyltransferase
 
Salmonella typhimurium LT2

Gene: STM0775: galactose-1-phosphate uridylyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02377: galactose-1-phosphate uridylyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00772: galactose-1-phosphate uridylyltransferase
 
Enterobacter sp. 638

Gene: Ent638_1249: galactose-1-phosphate uridylyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1197: galactose-1-phosphate uridylyltransferase
 
Yersinia pestis KIM

Gene: y3044: galactose-1-phosphate uridylyltransferase
*
Serratia proteamaculans 568

Site:
position = -143
score = 4.0472
sequence = TTTTTCGCTCTGGATCACCTTT

Gene: Spro_1292: galactose-1-phosphate uridylyltransferase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -154
score = 3.97714
sequence = TATAGTGAAACTGATTACATTG

Gene: ECA3171: galactose-1-phosphate uridylyltransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_2565: galactose-1-phosphate uridylyltransferase
 
Proteus mirabilis HI4320

Gene: PMI1950: galactose-1-phosphate uridylyltransferase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -120
score = 4.29301
sequence = TTGCGTGATTGGTATCTCAGAT

Gene: plu0575: galactose-1-phosphate uridylyltransferase
galactose-1-phosphate uridylyltransferase
galK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0757: galactokinase
 
Salmonella typhimurium LT2

Gene: STM0774: galactokinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02378: galactokinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00771: galactokinase
 
Enterobacter sp. 638

Gene: Ent638_1248: galactokinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1196: galactokinase
 
Yersinia pestis KIM

Gene: y3045: galactokinase
 
Serratia proteamaculans 568

Gene: Spro_1291: galactokinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3170: galactokinase
 
Edwardsiella tarda EIB202

Gene: ETAE_2566: galactokinase
 
Proteus mirabilis HI4320

Gene: PMI1949: galactokinase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0576: galactokinase
galactokinase
galM
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0756: aldose 1-epimerase
 
Salmonella typhimurium LT2

Gene: STM0773: aldose 1-epimerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02379: aldose 1-epimerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00770: aldose 1-epimerase
 
Enterobacter sp. 638

Gene: Ent638_1247: aldose 1-epimerase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1195: aldose 1-epimerase
 
Yersinia pestis KIM

Gene: y3046: aldose 1-epimerase
 
Serratia proteamaculans 568

Gene: Spro_1290: aldose 1-epimerase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1388: aldose 1-epimerase
 
Edwardsiella tarda EIB202

Gene: ETAE_2567: aldose 1-epimerase
 
Proteus mirabilis HI4320

Gene: PMI1948: aldose 1-epimerase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0577: aldose 1-epimerase
aldose 1-epimerase
 
CRON 78.
galP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -156
score = 3.62961
sequence = TATGATGATATAACTCAATTAT

Site:
position = -82
score = 4.94041
sequence = TGATGTGATTTGCTTCACATCT

Gene: b2943: sugar transporter
*
Salmonella typhimurium LT2

Site:
position = -83
score = 4.59563
sequence = CATTGTGATTAGCCTCACATCT

Gene: STM3091: sugar transporter
*
Citrobacter koseri ATCC BAA-895

Site:
position = -83
score = 5.31935
sequence = TAACGTGATTCGAATCACATAT

Gene: CKO_04318: sugar transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -84
score = 3.84278
sequence = AGCCGTGATTATAGTCACGTTT

Gene: KPN_03376: sugar transporter
*
Enterobacter sp. 638

Site:
position = -171
score = 3.8841
sequence = TATTGGGATGCACATCAACTCT

Site:
position = -102
score = 3.72471
sequence = TAGTGTAACCGATTACACCAAT

Site:
position = -84
score = 5.33386
sequence = CAATGTGATTTATCTCACATAT

Gene: Ent638_3347: sugar transporter
*
Erwinia amylovora ATCC 49946

Site:
position = -152
score = 4.14332
sequence = TCATGTGATCTGTCGCACAGTC

Gene: EAM_2827: sugar transporter
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -276
score = 4.49769
sequence = TGGTGTGATATCGGTTACATTT

Site:
position = -100
score = 3.62496
sequence = TTGTGTAATCGTTTCCACTAAT

Site:
position = -82
score = 4.57175
sequence = TAATGTGATCGCACTCACTTAC

Gene: Spro_1160: sugar transporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -275
score = 3.74899
sequence = CAAAGTGAAAACGATTACATTT

Site:
position = -61
score = 4.47381
sequence = TTATGTGATCATGCGCACTTTA

Gene: ETAE_2966: sugar transporter
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
sugar transporter
 
CRON 79.
gapA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -226
score = 5.296
sequence = AATCGTGATGAAAATCACATTT

Gene: b1779: glyceraldehyde-3-phosphate dehydrogenase
*
Salmonella typhimurium LT2

Site:
position = -226
score = 4.84818
sequence = AATCGTGACTGATGTCACATTA

Gene: STM1290: glyceraldehyde-3-phosphate dehydrogenase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -226
score = 5.01779
sequence = AATCGTGATCGGAATCACGTTT

Gene: CKO_01800: glyceraldehyde-3-phosphate dehydrogenase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -225
score = 5.17494
sequence = AATTGTGACTTAAATCACGTTT

Gene: KPN_01197: glyceraldehyde-3-phosphate dehydrogenase
*
Enterobacter sp. 638

Site:
position = -225
score = 5.71837
sequence = AATTGTGATCTTTCTCACATAT

Gene: Ent638_1675: glyceraldehyde-3-phosphate dehydrogenase
*
Erwinia amylovora ATCC 49946

Site:
position = -215
score = 5.44565
sequence = AATTGTGATGCAGATCACCATT

Gene: EAM_1931: glyceraldehyde-3-phosphate dehydrogenase
*
Yersinia pestis KIM

Site:
position = -218
score = 5.09442
sequence = AAATGTGATAAAAATCGCAAAT

Gene: y2165: glyceraldehyde-3-phosphate dehydrogenase
*
Serratia proteamaculans 568

Site:
position = -227
score = 5.61322
sequence = ATATGTGATACCGATCACATAT

Gene: Spro_2728: glyceraldehyde-3-phosphate dehydrogenase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -235
score = 5.8358
sequence = AATTGTGATGTGTATCACATAA

Gene: ECA2344: glyceraldehyde-3-phosphate dehydrogenase
*
Edwardsiella tarda EIB202

Site:
position = -227
score = 5.11534
sequence = TTTTGTGATGAGCATCACAAAC

Gene: ETAE_1483: glyceraldehyde-3-phosphate dehydrogenase
*
Proteus mirabilis HI4320

Site:
position = -226
score = 5.63362
sequence = AAATGTGATACATTTCACATAA

Gene: PMI1504: glyceraldehyde-3-phosphate dehydrogenase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -224
score = 5.38
sequence = TATTGTGATGTGACTCGCATAT

Gene: plu2558: glyceraldehyde-3-phosphate dehydrogenase
glyceraldehyde-3-phosphate dehydrogenase
yeaD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1780: Aldose 1-epimerase
 
Salmonella typhimurium LT2

Gene: STM1289: Aldose 1-epimerase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01801: Aldose 1-epimerase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01196: Aldose 1-epimerase
 
Enterobacter sp. 638

Gene: Ent638_1674: Aldose 1-epimerase
 
Erwinia amylovora ATCC 49946

Gene: EAM_1932: Aldose 1-epimerase
 
Yersinia pestis KIM

Gene: y2166: Aldose 1-epimerase
 
Serratia proteamaculans 568

Gene: Spro_2729: Aldose 1-epimerase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA2345: Aldose 1-epimerase
 
Edwardsiella tarda EIB202

Gene: ETAE_1482: Aldose 1-epimerase
 
Proteus mirabilis HI4320

Gene: PMI1505: Aldose 1-epimerase
 
Photorhabdus luminescens subsp. laumondii TTO1
Aldose 1-epimerase
 
CRON 80.
garD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -210
score = 4.23829
sequence = TATTTTGAGCATATGCACATAA

Site:
position = -127
score = 4.372
sequence = ATGATTGACATTGATCACATTT

Site:
position = -52
score = 3.74802
sequence = AAATGAGACCAGGTCCTCATTT

Gene: b3128: D-galactarate dehydratase
*
Salmonella typhimurium LT2

Site:
position = -153
score = 4.28764
sequence = TGCGGTGATCTGGATCACATTC

Gene: STM3250: D-galactarate dehydratase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -54
score = 3.96106
sequence = AGTTGTTCTCTTTAACACATTT

Gene: CKO_04527: D-galactarate dehydratase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -125
score = 4.79177
sequence = AGGAGTGATGCCGATCACATTT

Gene: KPN_03540: D-galactarate dehydratase
*
Enterobacter sp. 638

Site:
position = -143
score = 4.74751
sequence = AGGGGTGATCTTGATCACATTT

Gene: Ent638_3570: D-galactarate dehydratase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -296
score = 4.24662
sequence = TAGTGCGAGGTATTTCACGAAA

Site:
position = -204
score = 5.05939
sequence = AAATGTGATCAAACTCACCAAA

Gene: ECA3578: D-galactarate dehydratase
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
D-galactarate dehydratase
 
CRON 81.
garP
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -269
score = 4.35243
sequence = AAATGTGATCAATGTCAATCAT

Gene: b3127: d-galactonate transporter
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -289
score = 4.48682
sequence = AAATGTGATCGGCATCACTCCT

Gene: KPN_03539: d-galactonate transporter
*
Enterobacter sp. 638

Site:
position = -291
score = 4.71677
sequence = AAATGTGATCAAGATCACCCCT

Gene: Ent638_3569: d-galactonate transporter
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
d-galactonate transporter
garL
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3126: alpha-dehydro-beta-deoxy-D-glucarate aldolase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03538: alpha-dehydro-beta-deoxy-D-glucarate aldolase
 
Enterobacter sp. 638

Gene: Ent638_3568: alpha-dehydro-beta-deoxy-D-glucarate aldolase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
alpha-dehydro-beta-deoxy-D-glucarate aldolase
garR
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3125: tartronate semialdehyde reductase
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03537: tartronate semialdehyde reductase
 
Enterobacter sp. 638

Gene: Ent638_3567: tartronate semialdehyde reductase
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
tartronate semialdehyde reductase
garK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3124: glycerate kinase I
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03536: glycerate kinase I
 
Enterobacter sp. 638

Gene: Ent638_3566: glycerate kinase I
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
glycerate kinase I
 
CRON 82.
CKO_02295
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -218
score = 3.86251
sequence = TTTTGTTATCTCATTGAAAATT

Site:
position = -104
score = 4.06756
sequence = TTTTGTGCAAGTTTTCTCATTA

Gene: CKO_02295: hypothetical protein
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -103
score = 3.85244
sequence = TGAAATGAGCGAGATCGCATAT

Gene: KPN_00854: hypothetical protein
*
Enterobacter sp. 638

Site:
position = -122
score = 4.0525
sequence = TTTTGTGCAAGCTTTCTCATAA

Gene: Ent638_1314: hypothetical protein
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -299
score = 5.43284
sequence = TAATGTGACTTTGTTCACATTA

Site:
position = -122
score = 3.81959
sequence = TTCTTTGAAAGAATTCTCATAA

Site:
position = -21
score = 4.9017
sequence = TAATTTGAGGGAGATCACAAAA

Gene: y3231: hypothetical protein
*
Serratia proteamaculans 568

Site:
position = -130
score = 3.70721
sequence = AAACGTGGTTTTTTGCAAAAAT

Site:
position = -21
score = 4.62081
sequence = AAATTTGAAGGAGATCACAGAA

Gene: Spro_3600: hypothetical protein
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -21
score = 4.83087
sequence = AAAAGTGAACGGGATCACAAAA

Gene: ECA1966: hypothetical protein
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1
hypothetical protein
 
CRON 83.
glk
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -116
score = 4.05481
sequence = TTGTGTGACCCAGATCGATATT

Gene: b2388: glucokinase
*
Salmonella typhimurium LT2

Site:
position = -116
score = 3.86439
sequence = TTCTGTGATGAAGATCTATATT

Gene: STM2403: glucokinase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -116
score = 4.48658
sequence = TTATGTGATGCAGATCGATATT

Gene: CKO_00412: glucokinase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -117
score = 4.38443
sequence = AAATGTGACCTGTGTCGCTAAA

Gene: KPN_02738: glucokinase
*
Enterobacter sp. 638

Site:
position = -116
score = 3.7877
sequence = TTCTGTGACGAAGATCGATTAT

Gene: Ent638_2921: glucokinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2374: glucokinase
*
Yersinia pestis KIM

Site:
position = -113
score = 4.67689
sequence = TTATGAGATGTCAGTCACAAAA

Gene: y1505: glucokinase
*
Serratia proteamaculans 568

Site:
position = -116
score = 4.84944
sequence = TTTTGTGATCCGGATCGCTAAT

Gene: Spro_3407: glucokinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1401: glucokinase
 
Edwardsiella tarda EIB202

Gene: ETAE_1144: glucokinase
 
Proteus mirabilis HI4320
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1405: glucokinase
glucokinase
 
CRON 84.
glnA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -269
score = 4.17898
sequence = CTTTGTGATCGCTTTCACGGAG

Gene: b3870: glutamine synthetase
*
Salmonella typhimurium LT2

Site:
position = -272
score = 4.17898
sequence = CTTTGTGATCGCTTTCACGGAG

Site:
position = -114
score = 3.81469
sequence = CAATGTGAAAGTTGGCACAGAT

Gene: STM4007: glutamine synthetase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -250
score = 4.17898
sequence = CTTTGTGATCGCTTTCACGGAG

Gene: CKO_03140: glutamine synthetase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -299
score = 3.92234
sequence = CTTTGTGACCGCTTTCACGGAG

Gene: KPN_04178: glutamine synthetase
 
Enterobacter sp. 638

Gene: Ent638_4096: glutamine synthetase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0032: glutamine synthetase
 
Yersinia pestis KIM

Gene: y3804: glutamine synthetase
*
Serratia proteamaculans 568

Site:
position = -267
score = 3.99335
sequence = GTATGTGATCCCTTTCACGGTG

Gene: Spro_4881: glutamine synthetase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -265
score = 4.24195
sequence = CTTTGTGATCCCTTTCACGGTG

Gene: ECA0029: glutamine synthetase
*
Edwardsiella tarda EIB202

Site:
position = -267
score = 4.21121
sequence = GTTTGTGATCCTATTCACGATG

Gene: ETAE_3493: glutamine synthetase
*
Proteus mirabilis HI4320

Site:
position = -270
score = 4.65103
sequence = AATTGTGATCCTTTTCACGCCT

Site:
position = -215
score = 3.78638
sequence = AATTGTGCAACTATTCAGACTT

Site:
position = -181
score = 3.91255
sequence = ATTTGTGCAATAATTAAAAAAT

Gene: PMI2882: glutamine synthetase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0237: glutamine synthetase
glutamine synthetase
glnL
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3869: nitrogen regulation protein NR(II)
 
Salmonella typhimurium LT2

Gene: STM4006: nitrogen regulation protein NR(II)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03143: nitrogen regulation protein NR(II)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04177: nitrogen regulation protein NR(II)
 
Enterobacter sp. 638

Gene: Ent638_4097: nitrogen regulation protein NR(II)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0031: nitrogen regulation protein NR(II)
 
Yersinia pestis KIM

Gene: y3805: nitrogen regulation protein NR(II)
 
Serratia proteamaculans 568

Gene: Spro_4882: nitrogen regulation protein NR(II)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0028: nitrogen regulation protein NR(II)
 
Edwardsiella tarda EIB202

Gene: ETAE_3494: nitrogen regulation protein NR(II)
 
Proteus mirabilis HI4320

Gene: PMI2883: nitrogen regulation protein NR(II)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0236: nitrogen regulation protein NR(II)
nitrogen regulation protein NR(II)
glnG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3868: nitrogen regulation protein NR(I)
 
Salmonella typhimurium LT2

Gene: STM4005: nitrogen regulation protein NR(I)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03144: nitrogen regulation protein NR(I)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04176: nitrogen regulation protein NR(I)
 
Enterobacter sp. 638

Gene: Ent638_4098: nitrogen regulation protein NR(I)
 
Erwinia amylovora ATCC 49946

Gene: EAM_0030: nitrogen regulation protein NR(I)
 
Yersinia pestis KIM

Gene: y3806: nitrogen regulation protein NR(I)
 
Serratia proteamaculans 568

Gene: Spro_4883: nitrogen regulation protein NR(I)
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0027: nitrogen regulation protein NR(I)
 
Edwardsiella tarda EIB202

Gene: ETAE_3495: nitrogen regulation protein NR(I)
 
Proteus mirabilis HI4320

Gene: PMI2884: nitrogen regulation protein NR(I)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0235: nitrogen regulation protein NR(I)
nitrogen regulation protein NR(I)
 
CRON 85.
glpA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -165
score = 4.61974
sequence = AAATGTGAATTGCCGCACACAT

Gene: b2241: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Salmonella typhimurium LT2

Site:
position = -163
score = 4.96373
sequence = TAATGTGAATTACAGCACATAT

Gene: STM2284: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Citrobacter koseri ATCC BAA-895

Site:
position = -163
score = 4.66103
sequence = TAATGTGAATTACAGCACAGAT

Gene: CKO_00536: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -165
score = 4.32959
sequence = TACTGTGAAACATCGCACAATT

Site:
position = -115
score = 3.84564
sequence = ATGTGAGCACGAAATCACATAA

Gene: KPN_02647: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Enterobacter sp. 638

Site:
position = -163
score = 4.06945
sequence = TACTGTGAATCAACGCACAGAT

Gene: Ent638_2805: sn-glycerol-3-phosphate dehydrogenase subunit A
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -231
score = 3.64904
sequence = AATTGTTACCTATTTTATGAAA

Site:
position = -155
score = 4.41065
sequence = ACCTGTGATTTTGATCACAATC

Gene: y0404: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Serratia proteamaculans 568

Site:
position = -231
score = 3.60719
sequence = CGCTGTGATGGATGGCGCAATT

Site:
position = -138
score = 4.85126
sequence = AATCGTGATTATGATCACATTC

Gene: Spro_0200: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -148
score = 5.09063
sequence = TTTAGTGATGCAAATCACACTT

Gene: ECA4165: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Edwardsiella tarda EIB202

Site:
position = -247
score = 3.9562
sequence = TACTGTGAGAGATCGCTCATAT

Site:
position = -142
score = 4.7878
sequence = TAGAGTGATTTTGATCACATTG

Gene: ETAE_3115: sn-glycerol-3-phosphate dehydrogenase subunit A
*
Proteus mirabilis HI4320

Site:
position = -262
score = 3.73144
sequence = TACTGTGAAGTAATACTCAGTT

Site:
position = -170
score = 5.5011
sequence = ATTTGTGATTAGTATCACATAT

Gene: PMI3592: sn-glycerol-3-phosphate dehydrogenase subunit A
 
Photorhabdus luminescens subsp. laumondii TTO1
sn-glycerol-3-phosphate dehydrogenase subunit A
glpB
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2242: Glycerol-3-phosphate dehydrogenase subunit B
 
Salmonella typhimurium LT2

Gene: STM2285: Glycerol-3-phosphate dehydrogenase subunit B
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00535: Glycerol-3-phosphate dehydrogenase subunit B
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02648: Glycerol-3-phosphate dehydrogenase subunit B
 
Enterobacter sp. 638

Gene: Ent638_2806: Glycerol-3-phosphate dehydrogenase subunit B
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0405: Glycerol-3-phosphate dehydrogenase subunit B
 
Serratia proteamaculans 568

Gene: Spro_0201: Glycerol-3-phosphate dehydrogenase subunit B
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4164: Glycerol-3-phosphate dehydrogenase subunit B
 
Edwardsiella tarda EIB202

Gene: ETAE_3114: Glycerol-3-phosphate dehydrogenase subunit B
 
Proteus mirabilis HI4320

Gene: PMI3593: Glycerol-3-phosphate dehydrogenase subunit B
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1411: Glycerol-3-phosphate dehydrogenase subunit B
Glycerol-3-phosphate dehydrogenase subunit B
glpC
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2243: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Salmonella typhimurium LT2

Gene: STM2286: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00534: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02649: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Enterobacter sp. 638

Gene: Ent638_2807: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0406: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Serratia proteamaculans 568

Gene: Spro_0202: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4163: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Edwardsiella tarda EIB202

Gene: ETAE_3113: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Proteus mirabilis HI4320

Gene: PMI3594: anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
Photorhabdus luminescens subsp. laumondii TTO1
anaerobic glycerol-3-phosphate dehydrogenase subunit C
 
CRON 86.
glpD
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -116
score = 4.4313
sequence = TAATGTTATACATATCACTCTA

Gene: b3426: glycerol-3-phosphate dehydrogenase
*
Salmonella typhimurium LT2

Site:
position = -116
score = 4.4313
sequence = TAATGTTATACATATCACTCTA

Gene: STM3526: glycerol-3-phosphate dehydrogenase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -116
score = 4.48214
sequence = TAATGTTATATGTATCACTCTA

Gene: CKO_04845: glycerol-3-phosphate dehydrogenase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -119
score = 3.70738
sequence = ATATGTTACACCCATCACTTCA

Site:
position = -58
score = 3.73721
sequence = TATAGTGAGCGATATCGAGCAT

Gene: KPN_03792: glycerol-3-phosphate dehydrogenase
*
Enterobacter sp. 638

Site:
position = -116
score = 4.44723
sequence = TTATGTTATCTCTATCACTCAA

Site:
position = -55
score = 3.99564
sequence = TATTATGAGCGATATCGAACAT

Gene: Ent638_3835: glycerol-3-phosphate dehydrogenase
*
Erwinia amylovora ATCC 49946

Site:
position = -124
score = 4.01417
sequence = AGACGTTATCGGCATCACGCAT

Gene: EAM_3265: glycerol-3-phosphate dehydrogenase
*
Yersinia pestis KIM

Site:
position = -129
score = 4.44437
sequence = AAATGTTACCTCCATCACGCAT

Gene: y3891: glycerol-3-phosphate dehydrogenase
*
Serratia proteamaculans 568

Site:
position = -129
score = 3.61385
sequence = AACTGTTACCTCTATCACGCCT

Gene: Spro_4642: glycerol-3-phosphate dehydrogenase
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -144
score = 4.2738
sequence = TAATGTGACAACTATCATCATA

Site:
position = -124
score = 4.39251
sequence = TATTGTTAGCTTCATCACGCAT

Gene: ECA4141: glycerol-3-phosphate dehydrogenase
*
Edwardsiella tarda EIB202

Site:
position = -124
score = 4.27321
sequence = TTGTGTTATCCGCATCGCGTAA

Gene: ETAE_3312: glycerol-3-phosphate dehydrogenase
*
Proteus mirabilis HI4320

Site:
position = -129
score = 4.42183
sequence = AATTGTTATTTATATCACGCAG

Gene: PMI2930: glycerol-3-phosphate dehydrogenase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0194: glycerol-3-phosphate dehydrogenase
glycerol-3-phosphate dehydrogenase
 
CRON 87.
glpE
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -95
score = 4.68288
sequence = TAGAGTGATATGTATAACATTA

Gene: b3425: thiosulfate sulfurtransferase
*
Salmonella typhimurium LT2

Site:
position = -104
score = 4.68288
sequence = TAGAGTGATATGTATAACATTA

Gene: STM3525: thiosulfate sulfurtransferase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -108
score = 4.63204
sequence = TAGAGTGATACATATAACATTA

Gene: CKO_04844: thiosulfate sulfurtransferase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -107
score = 4.32318
sequence = TGAAGTGATGGGTGTAACATAT

Gene: KPN_03791: thiosulfate sulfurtransferase
*
Enterobacter sp. 638

Site:
position = -257
score = 3.83747
sequence = ATGTTCGATATCGCTCATAATA

Site:
position = -196
score = 4.592
sequence = TTGAGTGATAGAGATAACATAA

Gene: Ent638_3834: thiosulfate sulfurtransferase
*
Erwinia amylovora ATCC 49946

Site:
position = -134
score = 3.91294
sequence = ATGCGTGATGCCGATAACGTCT

Gene: EAM_3264: thiosulfate sulfurtransferase
 
Yersinia pestis KIM

Gene: y3899: thiosulfate sulfurtransferase
 
Serratia proteamaculans 568

Gene: Spro_4638: thiosulfate sulfurtransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4139: thiosulfate sulfurtransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_3316: thiosulfate sulfurtransferase
 
Proteus mirabilis HI4320

Gene: PMI2927: thiosulfate sulfurtransferase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -102
score = 3.64417
sequence = TAACGTATTACTGATAACAAAT

Gene: plu0197: thiosulfate sulfurtransferase
thiosulfate sulfurtransferase
glpG
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3424: predicted intramembrane serine protease
 
Salmonella typhimurium LT2

Gene: STM3524: predicted intramembrane serine protease
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04842: predicted intramembrane serine protease
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03790: predicted intramembrane serine protease
 
Enterobacter sp. 638

Gene: Ent638_3833: predicted intramembrane serine protease
 
Erwinia amylovora ATCC 49946

Gene: EAM_3263: predicted intramembrane serine protease
 
Yersinia pestis KIM

Gene: y3898: predicted intramembrane serine protease
 
Serratia proteamaculans 568

Gene: Spro_4639: predicted intramembrane serine protease
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4138: predicted intramembrane serine protease
 
Edwardsiella tarda EIB202

Gene: ETAE_3314: predicted intramembrane serine protease
 
Proteus mirabilis HI4320

Gene: PMI2928: predicted intramembrane serine protease
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0196: predicted intramembrane serine protease
predicted intramembrane serine protease
glpR2
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3423: DNA-binding transcriptional repressor
 
Salmonella typhimurium LT2

Gene: STM3523: DNA-binding transcriptional repressor
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04841: DNA-binding transcriptional repressor
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03789: DNA-binding transcriptional repressor
 
Enterobacter sp. 638

Gene: Ent638_3832: DNA-binding transcriptional repressor
 
Erwinia amylovora ATCC 49946

Gene: EAM_3262: DNA-binding transcriptional repressor
 
Yersinia pestis KIM

Gene: y3897: DNA-binding transcriptional repressor
 
Serratia proteamaculans 568

Gene: Spro_4640: DNA-binding transcriptional repressor
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4137: DNA-binding transcriptional repressor
 
Edwardsiella tarda EIB202

Gene: ETAE_3313: DNA-binding transcriptional repressor
*
Proteus mirabilis HI4320

Site:
position = -32
score = 3.78036
sequence = TAACATGATATTTTTAACTTTA

Gene: PMI2929: DNA-binding transcriptional repressor
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0195: DNA-binding transcriptional repressor
DNA-binding transcriptional repressor
 
CRON 88.
glpF
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -142
score = 4.0255
sequence = TTTTATGACGAGGCACACACAT

Gene: b3927: facilitator for glycerol uptake
*
Salmonella typhimurium LT2

Site:
position = -147
score = 3.91875
sequence = TTTATTGACGCAGTACACACAT

Gene: STM4087: facilitator for glycerol uptake
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03071: facilitator for glycerol uptake
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -145
score = 3.68737
sequence = TTTCTTGACGAGACACACACAT

Gene: KPN_04010: facilitator for glycerol uptake
*
Enterobacter sp. 638

Site:
position = -213
score = 4.41283
sequence = TGAAATGATTCAGCTCACATTT

Site:
position = -147
score = 3.79876
sequence = TTTATTGACACAGCACACACAT

Gene: Ent638_4046: facilitator for glycerol uptake
*
Erwinia amylovora ATCC 49946

Site:
position = -146
score = 4.09415
sequence = TTTCATGACGCGGTACACATTT

Gene: EAM_0119: facilitator for glycerol uptake
*
Yersinia pestis KIM

Site:
position = -139
score = 3.96442
sequence = TTTCATGACGAATAACACATAT

Gene: y0046: facilitator for glycerol uptake
*
Serratia proteamaculans 568

Site:
position = -183
score = 4.06381
sequence = TTTTATGACGAAGCACACACAT

Gene: Spro_4797: facilitator for glycerol uptake
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -153
score = 4.29384
sequence = TTTTTTGACGCGCAACACACAT

Gene: ECA4266: facilitator for glycerol uptake
*
Edwardsiella tarda EIB202

Site:
position = -139
score = 3.92502
sequence = TTTTTTGACGACACACACACAT

Gene: ETAE_3441: facilitator for glycerol uptake
*
Proteus mirabilis HI4320

Site:
position = -132
score = 4.0186
sequence = TTTCATGATGGGACACACAAAA

Gene: PMI3211: facilitator for glycerol uptake
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4767: facilitator for glycerol uptake
facilitator for glycerol uptake
glpK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3926: glycerol kinase
 
Salmonella typhimurium LT2

Gene: STM4086: glycerol kinase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03072: glycerol kinase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04011: glycerol kinase
 
Enterobacter sp. 638

Gene: Ent638_4047: glycerol kinase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0118: glycerol kinase
 
Yersinia pestis KIM

Gene: y0047: glycerol kinase
 
Serratia proteamaculans 568

Gene: Spro_4798: glycerol kinase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4267: glycerol kinase
 
Edwardsiella tarda EIB202

Gene: ETAE_3442: glycerol kinase
 
Proteus mirabilis HI4320

Gene: PMI3210: glycerol kinase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4768: glycerol kinase
glycerol kinase
glpX
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3925: fructose 1,6-bisphosphatase II
 
Salmonella typhimurium LT2

Gene: STM4085: fructose 1,6-bisphosphatase II
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03075: fructose 1,6-bisphosphatase II
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04001: fructose 1,6-bisphosphatase II
 
Enterobacter sp. 638

Gene: Ent638_4048: fructose 1,6-bisphosphatase II
 
Erwinia amylovora ATCC 49946

Gene: EAM_0116: fructose 1,6-bisphosphatase II
 
Yersinia pestis KIM

Gene: y0048: fructose 1,6-bisphosphatase II
 
Serratia proteamaculans 568

Gene: Spro_4799: fructose 1,6-bisphosphatase II
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4268: fructose 1,6-bisphosphatase II
 
Edwardsiella tarda EIB202

Gene: ETAE_3443: fructose 1,6-bisphosphatase II
 
Proteus mirabilis HI4320

Gene: PMI1524: fructose 1,6-bisphosphatase II
 
Photorhabdus luminescens subsp. laumondii TTO1
fructose 1,6-bisphosphatase II
 
CRON 89.
glpT
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -219
score = 3.7132
sequence = TTGTTTGATTTCGCGCATATTC

Site:
position = -179
score = 3.59152
sequence = AAACGTGATTTCATGCGTCATT

Site:
position = -129
score = 4.57229
sequence = ATGTGTGCGGCAATTCACATTT

Gene: b2240: glycerol-3-phosphate transporter
*
Salmonella typhimurium LT2

Site:
position = -220
score = 3.62417
sequence = ATGTTTGATTTCGCGCATAATC

Site:
position = -180
score = 4.23286
sequence = AAACGTGATTTCGTGCGCCTTT

Site:
position = -131
score = 5.18997
sequence = ATATGTGCTGTAATTCACATTA

Gene: STM2283: glycerol-3-phosphate transporter
*
Citrobacter koseri ATCC BAA-895

Site:
position = -221
score = 3.63076
sequence = TTGTTTGATTTCGCGCATAATC

Site:
position = -181
score = 4.03763
sequence = AAACGTGATTTCGTGCGCTTTT

Site:
position = -132
score = 4.81645
sequence = ATCTGTGCTGTAATTCACATTA

Gene: CKO_00537: glycerol-3-phosphate transporter
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -218
score = 3.81476
sequence = TTGTTTGATTTCGAGCATATTC

Site:
position = -178
score = 4.57905
sequence = TTATGTGATTTCGTGCTCACAT

Site:
position = -128
score = 4.5342
sequence = AATTGTGCGATGTTTCACAGTA

Gene: KPN_02646: glycerol-3-phosphate transporter
*
Enterobacter sp. 638

Site:
position = -201
score = 3.63207
sequence = TTGTTTGATTTCGAACATAATC

Site:
position = -161
score = 3.8242
sequence = AAGCGTGATCTCATGCGCTTAT

Site:
position = -111
score = 4.04921
sequence = ATCTGTGCGTTGATTCACAGTA

Gene: Ent638_2804: glycerol-3-phosphate transporter
*
Erwinia amylovora ATCC 49946

Site:
position = -240
score = 3.68948
sequence = AAACGCGATGCGGTTAACGATG

Site:
position = -147
score = 3.70558
sequence = ATTTGTGCCTCTCTTCACGGTC

Gene: EAM_0195: glycerol-3-phosphate transporter
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -249
score = 4.48018
sequence = GAATGTGATCATAATCACGATT

Gene: Spro_0199: glycerol-3-phosphate transporter
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -253
score = 3.70995
sequence = ATGTTTGATAAAGAGCAAAAAC

Site:
position = -193
score = 4.88762
sequence = AAGTGTGATTTGCATCACTAAA

Gene: ECA4166: glycerol-3-phosphate transporter
*
Edwardsiella tarda EIB202

Site:
position = -200
score = 3.66184
sequence = ATATGAGCGATCTCTCACAGTA

Gene: ETAE_3116: glycerol-3-phosphate transporter
*
Proteus mirabilis HI4320

Site:
position = -291
score = 3.59797
sequence = ATGTTTGATAATGAGCAAAAAC

Site:
position = -232
score = 5.43385
sequence = ATATGTGATACTAATCACAAAT

Gene: PMI3591: glycerol-3-phosphate transporter
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -250
score = 4.92699
sequence = TATTGTGACAATTGTCACAATT

Gene: plu4119: glycerol-3-phosphate transporter
glycerol-3-phosphate transporter
glpQ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2239: glycerophosphoryl diester phosphodiesterase
 
Salmonella typhimurium LT2

Gene: STM2282: glycerophosphoryl diester phosphodiesterase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00538: glycerophosphoryl diester phosphodiesterase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02645: glycerophosphoryl diester phosphodiesterase
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0403: glycerophosphoryl diester phosphodiesterase
 
Serratia proteamaculans 568

Gene: Spro_0198: glycerophosphoryl diester phosphodiesterase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4167: glycerophosphoryl diester phosphodiesterase
 
Edwardsiella tarda EIB202

Gene: ETAE_3117: glycerophosphoryl diester phosphodiesterase
 
Proteus mirabilis HI4320

Gene: PMI3590: glycerophosphoryl diester phosphodiesterase
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4120: glycerophosphoryl diester phosphodiesterase
glycerophosphoryl diester phosphodiesterase
 
CRON 90.
glnH2
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0655: glutamate and aspartate transporter subunit
*
Salmonella typhimurium LT2

Site:
position = -87
score = 4.04829
sequence = AAATGTTAACAAACACACATAA

Gene: STM0665: glutamate and aspartate transporter subunit
*
Citrobacter koseri ATCC BAA-895

Site:
position = -67
score = 3.69887
sequence = AAATGTTAACAAACACGCATAA

Gene: CKO_02507: glutamate and aspartate transporter subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00681: glutamate and aspartate transporter subunit
*
Enterobacter sp. 638

Site:
position = -106
score = 3.79951
sequence = AAATGTTAACAAGCTTGCATAA

Gene: Ent638_1182: glutamate and aspartate transporter subunit
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -268
score = 3.84963
sequence = TGGTGCGATTCGTGTCTCAAAA

Gene: y1189: glutamate and aspartate transporter subunit
 
Serratia proteamaculans 568

Gene: Spro_1214: glutamate and aspartate transporter subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1314: glutamate and aspartate transporter subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_2632: glutamate and aspartate transporter subunit
*
Proteus mirabilis HI4320

Site:
position = -142
score = 3.9834
sequence = TATTGAGAGATAGCTCTCGTAT

Gene: PMI0437: glutamate and aspartate transporter subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1307: glutamate and aspartate transporter subunit
glutamate and aspartate transporter subunit
gltJ
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0654: glutamate/aspartate ABC transporter, permease protein
 
Salmonella typhimurium LT2

Gene: STM0664: glutamate/aspartate ABC transporter, permease protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02509: glutamate/aspartate ABC transporter, permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00680: glutamate/aspartate ABC transporter, permease protein
 
Enterobacter sp. 638

Gene: Ent638_1181: glutamate/aspartate ABC transporter, permease protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1188: glutamate/aspartate ABC transporter, permease protein
 
Serratia proteamaculans 568

Gene: Spro_1213: glutamate/aspartate ABC transporter, permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2633: glutamate/aspartate ABC transporter, permease protein
 
Proteus mirabilis HI4320

Gene: PMI0436: glutamate/aspartate ABC transporter, permease protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1306: glutamate/aspartate ABC transporter, permease protein
glutamate/aspartate ABC transporter, permease protein
gltK
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0653: glutamate/aspartate ABC transporter, permease protein
 
Salmonella typhimurium LT2

Gene: STM0663: glutamate/aspartate ABC transporter, permease protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02510: glutamate/aspartate ABC transporter, permease protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00679: glutamate/aspartate ABC transporter, permease protein
 
Enterobacter sp. 638

Gene: Ent638_1180: glutamate/aspartate ABC transporter, permease protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1187: glutamate/aspartate ABC transporter, permease protein
 
Serratia proteamaculans 568

Gene: Spro_1212: glutamate/aspartate ABC transporter, permease protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2634: glutamate/aspartate ABC transporter, permease protein
 
Proteus mirabilis HI4320

Gene: PMI0435: glutamate/aspartate ABC transporter, permease protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1305: glutamate/aspartate ABC transporter, permease protein
glutamate/aspartate ABC transporter, permease protein
gltL
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0652: ABC transporter-related protein
 
Salmonella typhimurium LT2

Gene: STM0662: ABC transporter-related protein
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02511: ABC transporter-related protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_00678: ABC transporter-related protein
 
Enterobacter sp. 638

Gene: Ent638_1179: ABC transporter-related protein
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y1186: ABC transporter-related protein
 
Serratia proteamaculans 568

Gene: Spro_1211: ABC transporter-related protein
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_2635: ABC transporter-related protein
 
Proteus mirabilis HI4320

Gene: PMI0434: ABC transporter-related protein
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1304: ABC transporter-related protein
ABC transporter-related protein
 
CRON 91.
gltS
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3653: sodium/glutamate symporter
 
Salmonella typhimurium LT2

Gene: STM3746: sodium/glutamate symporter
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_04012: sodium/glutamate symporter
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
*
Yersinia pestis KIM

Site:
position = -148
score = 3.77097
sequence = ATTTTTTTGCTAACTCACATTT

Gene: y0106: sodium/glutamate symporter
*
Serratia proteamaculans 568

Site:
position = -208
score = 3.98064
sequence = TTTAATGATTTGACCCACAAAA

Gene: Spro_4872: sodium/glutamate symporter
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -199
score = 3.99545
sequence = TTTAATGATCTGCGCCACAAAA

Gene: ETAE_0026: sodium/glutamate symporter
*
Proteus mirabilis HI4320

Site:
position = -210
score = 3.99545
sequence = TTTAATGATCTGCGCCACAAAA

Gene: PMI2867: sodium/glutamate symporter
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0248: sodium/glutamate symporter
sodium/glutamate symporter
 
CRON 92.
glyA
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -229
score = 3.78123
sequence = GAATGTGATGAAGTGAAAAATT

Gene: b2551: serine hydroxymethyltransferase
 
Salmonella typhimurium LT2

Gene: STM2555: serine hydroxymethyltransferase
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00237: serine hydroxymethyltransferase
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02876: serine hydroxymethyltransferase
 
Enterobacter sp. 638

Gene: Ent638_3036: serine hydroxymethyltransferase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2497: serine hydroxymethyltransferase
 
Yersinia pestis KIM

Gene: y1322: serine hydroxymethyltransferase
 
Serratia proteamaculans 568

Gene: Spro_3638: serine hydroxymethyltransferase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3250: serine hydroxymethyltransferase
 
Edwardsiella tarda EIB202

Gene: ETAE_2821: serine hydroxymethyltransferase
*
Proteus mirabilis HI4320

Site:
position = -210
score = 3.76779
sequence = TAGCGAGATGTGCCTCAAAAAG

Gene: PMI1867: serine hydroxymethyltransferase
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -178
score = 3.83733
sequence = TAGCGTAATTTTCATTACACTA

Gene: plu3291: serine hydroxymethyltransferase
serine hydroxymethyltransferase
 
CRON 93.
gnd
 
Escherichia coli str. K-12 substr. MG1655

Gene: b2029: 6-phosphogluconate dehydrogenase
 
Salmonella typhimurium LT2

Gene: STM2081: gluconate-6-phosphate dehydrogenase, decarboxylating
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00756: hypothetical protein
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_02499: 6-phosphogluconate dehydrogenase
*
Enterobacter sp. 638

Site:
position = -116
score = 3.95336
sequence = CAGTGTGACATAGATCAGCAAA

Gene: Ent638_2642: 6-phosphogluconate dehydrogenase
 
Erwinia amylovora ATCC 49946

Gene: EAM_2150: 6-phosphogluconate dehydrogenase, decarboxylating
*
Yersinia pestis KIM

Site:
position = -78
score = 3.8424
sequence = AGTTGTGCTATCTATCGCACCA

Site:
position = -76
score = 3.61736
sequence = TTGTGCTATCTATCGCACCAAT

Gene: y2629: gluconate-6-phosphate dehydrogenase
*
Serratia proteamaculans 568

Site:
position = -297
score = 3.73977
sequence = ATGCTTGAAGTGGCTCTCACTT

Site:
position = -72
score = 4.15315
sequence = ACATGTGTGCCACATCACAAAA

Gene: Spro_1608: 6-phosphogluconate dehydrogenase, decarboxylating
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA1444: 6-phosphogluconate dehydrogenase, decarboxylating
 
Edwardsiella tarda EIB202

Gene: ETAE_1212: 6-phosphogluconate dehydrogenase
*
Proteus mirabilis HI4320

Site:
position = -71
score = 4.72888
sequence = CTATGTGATCAGGTTAACAAAT

Gene: PMI0655: 6-phosphogluconate dehydrogenase, decarboxylating
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -74
score = 4.41949
sequence = ACATGTGATCACATTAACAAAT

Gene: plu1560: 6-phosphogluconate dehydrogenase, decarboxylating
hypothetical protein
 
CRON 94.
gntK
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -132
score = 4.805
sequence = AAATTTGAAGTAGCTCACACTT

Gene: b3437: gluconate kinase 1
*
Salmonella typhimurium LT2

Site:
position = -132
score = 4.43148
sequence = AACTTTGAAGTAGCTCACACTT

Gene: STM3542: gluconate kinase 1
*
Citrobacter koseri ATCC BAA-895

Site:
position = -172
score = 4.805
sequence = AAATTTGAAGTAGCTCACACTT

Gene: CKO_04856: gluconate kinase 1
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -129
score = 4.70209
sequence = AAGTTTGAAGTAGATCACACAT

Gene: KPN_03801: gluconate kinase 1
*
Enterobacter sp. 638

Site:
position = -120
score = 4.62987
sequence = AAGTTTGAACTAGCTCACACTT

Gene: Ent638_3845: gluconate kinase 1
*
Erwinia amylovora ATCC 49946

Site:
position = -129
score = 4.55871
sequence = TTTTTTGACAGTCTTCACACTT

Gene: EAM_3275: gluconate kinase 1
 
Yersinia pestis KIM
*
Serratia proteamaculans 568

Site:
position = -144
score = 4.25883
sequence = AAACTTGAAGCCGATCACAGAT

Gene: Spro_4497: gluconate kinase 1
 
Erwinia carotovora subsp. atroseptica SCRI1043
*
Edwardsiella tarda EIB202

Site:
position = -142
score = 3.92706
sequence = AACTGCGAGTAGCATCACAGTT

Gene: ETAE_0135: gluconate kinase 1
*
Proteus mirabilis HI4320

Site:
position = -137
score = 4.47491
sequence = ATTTGCGAGACGCTTCACACTT

Gene: PMI2673: gluconate kinase 1
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -136
score = 5.53941
sequence = ATTTGTGATAAATATCACATTT

Gene: plu0497: gluconate kinase 1
gluconate kinase 1
gntU
 
Escherichia coli str. K-12 substr. MG1655

Gene: b4476: Low-affinity gluconate transporter (Gluconate permease)
 
Salmonella typhimurium LT2

Gene: STM3541: Low-affinity gluconate transporter (Gluconate permease)
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04855: Low-affinity gluconate transporter (Gluconate permease)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03800: Low-affinity gluconate transporter (Gluconate permease)
 
Enterobacter sp. 638

Gene: Ent638_3844: Low-affinity gluconate transporter (Gluconate permease)
 
Erwinia amylovora ATCC 49946

Gene: EAM_3274: Low-affinity gluconate transporter (Gluconate permease)
 
Yersinia pestis KIM
 
Serratia proteamaculans 568

Gene: Spro_4498: Low-affinity gluconate transporter (Gluconate permease)
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202

Gene: ETAE_0134: Low-affinity gluconate transporter (Gluconate permease)
 
Proteus mirabilis HI4320

Gene: PMI2672: Low-affinity gluconate transporter (Gluconate permease)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu0498: Low-affinity gluconate transporter (Gluconate permease)
Low-affinity gluconate transporter (Gluconate permease)
 
CRON 95.
gltB
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -199
score = 4.15029
sequence = AATTTTGCGCTAAAGCACATTT

Gene: b3212: glutamate synthase, large subunit
*
Salmonella typhimurium LT2

Site:
position = -288
score = 3.66467
sequence = ATCTGTGCTACAGCACACTTTT

Gene: STM3330: glutamate synthase, large subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04620: glutamate synthase, large subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03624: glutamate synthase, large subunit
*
Enterobacter sp. 638

Site:
position = -298
score = 3.85067
sequence = GATAGTGAGTCAGATCACACTC

Gene: Ent638_3656: glutamate synthase, large subunit
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0128: glutamate synthase, large subunit
 
Serratia proteamaculans 568

Gene: Spro_4344: glutamate synthase, large subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0312: glutamate synthase, large subunit
*
Edwardsiella tarda EIB202

Site:
position = -278
score = 4.8576
sequence = AACTGTGATGCAGCCCACATTT

Gene: ETAE_0527: glutamate synthase, large subunit
 
Proteus mirabilis HI4320

Gene: PMI3677: glutamate synthase, large subunit
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -241
score = 4.04
sequence = ATATTTGACCTGATTTATATTT

Gene: plu4009: glutamate synthase, large subunit
glutamate synthase, large subunit
gltD
 
Escherichia coli str. K-12 substr. MG1655

Gene: b3213: glutamate synthase, small subunit
 
Salmonella typhimurium LT2

Gene: STM3331: glutamate synthase, small subunit
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_04622: glutamate synthase, small subunit
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03625: glutamate synthase, small subunit
 
Enterobacter sp. 638

Gene: Ent638_3657: glutamate synthase, small subunit
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM

Gene: y0129: glutamate synthase, small subunit
 
Serratia proteamaculans 568

Gene: Spro_4345: glutamate synthase, small subunit
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0311: glutamate synthase, small subunit
 
Edwardsiella tarda EIB202

Gene: ETAE_0526: glutamate synthase, small subunit
 
Proteus mirabilis HI4320

Gene: PMI3676: glutamate synthase, small subunit
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu4010: glutamate synthase, small subunit
glutamate synthase, small subunit
 
CRON 96.
hemC
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -236
score = 4.20432
sequence = AAACGTGATCAATTTAACACCT

Gene: b3805: porphobilinogen deaminase
*
Salmonella typhimurium LT2

Site:
position = -219
score = 4.20432
sequence = AAACGTGATCAATTTAACACCT

Gene: STM3938: porphobilinogen deaminase
*
Citrobacter koseri ATCC BAA-895

Site:
position = -220
score = 4.20432
sequence = AAACGTGATCAATTTAACACCT

Gene: CKO_00147: porphobilinogen deaminase
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -232
score = 4.20432
sequence = AAACGTGATCAATTTAACACCT

Gene: KPN_04304: porphobilinogen deaminase
*
Enterobacter sp. 638

Site:
position = -211
score = 4.158
sequence = AAACGTGATCAATCTAACACCT

Gene: Ent638_3987: porphobilinogen deaminase
 
Erwinia amylovora ATCC 49946

Gene: EAM_0180: porphobilinogen deaminase
 
Yersinia pestis KIM

Gene: y0381: porphobilinogen deaminase
*
Serratia proteamaculans 568

Site:
position = -223
score = 4.158
sequence = AAACGTGATCAATCTAACACCT

Gene: Spro_0178: porphobilinogen deaminase
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA4188: porphobilinogen deaminase
*