Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 3 1
Ralstonia pickettii 12J 3 1
Ralstonia metallidurans CH34 5 1
Ralstonia eutropha JMP134 6 2
Ralstonia eutropha H16 6 2
Cupriavidus taiwanensis 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fabH
 
Ralstonia solanacearum GMI1000

Gene: RSc1050: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
 
Ralstonia pickettii 12J

Gene: Rpic_0915: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Ralstonia metallidurans CH34

Site:
position = -226
score = 2.48215
sequence = CATCAAACGCGGGTATGATG

Gene: Rmet_2430: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Ralstonia eutropha JMP134

Site:
position = -198
score = 2.48215
sequence = GATCAAACGCGGGTATGATG

Gene: Reut_A2265: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Ralstonia eutropha H16

Site:
position = -200
score = 2.48215
sequence = CATCAAACGCGGGTATGATG

Gene: H16_A2569: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
*
Cupriavidus taiwanensis

Site:
position = -201
score = 2.48215
sequence = CATCAAACGCGGGTATGATG

Gene: RALTA_A2072: 3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
3-oxoacyl-[acyl-carrier-protein] synthase, KASIII (EC 2.3.1.41)
fabD
 
Ralstonia solanacearum GMI1000

Gene: RSc1051: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Ralstonia pickettii 12J

Gene: Rpic_0916: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Ralstonia metallidurans CH34

Gene: Rmet_2429: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Ralstonia eutropha JMP134

Gene: Reut_A2264: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Ralstonia eutropha H16

Gene: H16_A2568: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
 
Cupriavidus taiwanensis

Gene: RALTA_A2071: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39)
fabG
 
Ralstonia solanacearum GMI1000

Gene: RSc1052: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia pickettii 12J

Gene: Rpic_0917: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia metallidurans CH34

Gene: Rmet_2428: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia eutropha JMP134

Gene: Reut_A2263: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia eutropha H16

Gene: H16_A2567: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Cupriavidus taiwanensis

Gene: RALTA_A2070: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
acpP
 
Ralstonia solanacearum GMI1000

Gene: RSc1053: Acyl carrier protein
 
Ralstonia pickettii 12J

Gene: Rpic_0918: Acyl carrier protein
 
Ralstonia metallidurans CH34

Gene: Rmet_2427: Acyl carrier protein
 
Ralstonia eutropha JMP134

Gene: Reut_A2262: Acyl carrier protein
 
Ralstonia eutropha H16

Gene: H16_A2566: Acyl carrier protein
 
Cupriavidus taiwanensis

Gene: RALTA_A2069: Acyl carrier protein
Acyl carrier protein
fabF
 
Ralstonia solanacearum GMI1000

Gene: RSc1054: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Ralstonia pickettii 12J

Gene: Rpic_0919: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Ralstonia metallidurans CH34

Gene: Rmet_2426: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Ralstonia eutropha JMP134

Gene: Reut_A2261: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Ralstonia eutropha H16

Gene: H16_A2565: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
Cupriavidus taiwanensis

Gene: RALTA_A2067: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
 
CRON 2.
psrA
*
Ralstonia solanacearum GMI1000

Site:
position = -122
score = 4.62286
sequence = TTTAAAACATCCGTTCCTAA

Gene: RS04928: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Ralstonia pickettii 12J

Site:
position = -121
score = 4.47718
sequence = TTTCAAACGTCTGTTCCTAA

Gene: Rpic_0418: Transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Ralstonia metallidurans CH34

Gene: Rmet_3595: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Ralstonia eutropha JMP134

Site:
position = -120
score = 3.62337
sequence = ATTAGAGCAGGCATTCGAAT

Gene: Reut_A3446: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Ralstonia eutropha H16

Site:
position = -104
score = 4.01482
sequence = CTTCGTACAGCTGTTTCAAG

Gene: H16_A3736: Transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Cupriavidus taiwanensis

Site:
position = -105
score = 4.01482
sequence = CTTCGTACAGCTGTTTCAAG

Gene: RALTA_A3194: Transcriptional regulator for fatty acid degradation PsrA, TetR family
Transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
 
Ralstonia solanacearum GMI1000

Gene: RS04929: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Ralstonia pickettii 12J

Gene: Rpic_0417: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
fabG
 
Ralstonia solanacearum GMI1000

Gene: RS04930: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia pickettii 12J

Gene: Rpic_0416: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD