Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 62 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 8 5
Ralstonia pickettii 12J 8 5
Ralstonia metallidurans CH34 13 10
Ralstonia eutropha JMP134 12 9
Ralstonia eutropha H16 13 10
Cupriavidus taiwanensis 16 11
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
H16_B2553
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -42
score = 6.26715
sequence = CACTGTATATTTATACAGTG

Gene: Rmet_5910: Conserved hypothetical protein
*
Ralstonia eutropha JMP134

Site:
position = -51
score = 6.04477
sequence = GACTGTATATTCGTACAGTA

Gene: Reut_B5317: Conserved hypothetical protein
*
Ralstonia eutropha H16

Site:
position = -51
score = 6.04477
sequence = GACTGTATATTCGTACAGTA

Gene: H16_B2553: Conserved hypothetical protein
*
Cupriavidus taiwanensis

Site:
position = -42
score = 6.04477
sequence = GACTGTATATTCGTACAGTA

Gene: RALTA_B2284: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 2.
recA
*
Ralstonia solanacearum GMI1000

Site:
position = -180
score = 5.45985
sequence = CACTGGTTTTTTATACAGTA

Gene: RSc0551: Recombinase A
*
Ralstonia pickettii 12J

Site:
position = -172
score = 5.45985
sequence = CACTGGTTTTTTATACAGTA

Gene: Rpic_0471: Recombinase A
*
Ralstonia metallidurans CH34

Site:
position = -171
score = 6.06005
sequence = TACTGTTTTTTTATACAGTA

Gene: Rmet_0466: Recombinase A
*
Ralstonia eutropha JMP134

Site:
position = -194
score = 6.06005
sequence = TACTGTTTTTTTATACAGTA

Gene: Reut_A0527: Recombinase A
*
Ralstonia eutropha H16

Site:
position = -159
score = 6.06005
sequence = TACTGTTTTTTTATACAGTA

Gene: H16_A0544: Recombinase A
*
Cupriavidus taiwanensis

Site:
position = -159
score = 6.06005
sequence = TACTGTTTTTTTATACAGTA

Gene: RALTA_A0499: Recombinase A
Recombinase A
recX
 
Ralstonia solanacearum GMI1000

Gene: RSc0552: Regulatory protein RecX
 
Ralstonia pickettii 12J

Gene: Rpic_0472: Regulatory protein RecX
 
Ralstonia metallidurans CH34

Gene: Rmet_0467: Regulatory protein RecX
 
Ralstonia eutropha JMP134

Gene: Reut_A0528: Regulatory protein RecX
 
Ralstonia eutropha H16

Gene: H16_A0545: Regulatory protein RecX
 
Cupriavidus taiwanensis

Gene: RALTA_A0500: Regulatory protein RecX
Regulatory protein RecX
 
CRON 3.
lexA
*
Ralstonia solanacearum GMI1000

Site:
position = -25
score = 5.44599
sequence = ACCTGTTCAAATATACAGTG

Site:
position = -44
score = 5.2999
sequence = CACTGTATAAAATCACAGCA

Gene: RSc1304: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Ralstonia pickettii 12J

Site:
position = -25
score = 5.44599
sequence = ACCTGTTCAAATATACAGTG

Site:
position = -44
score = 5.2999
sequence = CACTGTATAAAATCACAGCA

Gene: Rpic_1179: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Ralstonia metallidurans CH34

Site:
position = -43
score = 6.03503
sequence = TACTGTTTAAACATACAGTG

Site:
position = -63
score = 5.4495
sequence = TACTGTATAAAATCACAGCA

Gene: Rmet_1981: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Ralstonia eutropha JMP134

Site:
position = -74
score = 6.03503
sequence = TACTGTTTAAACATACAGTG

Site:
position = -95
score = 5.00222
sequence = TACTGTATAAAATCACAGGC

Gene: Reut_A2008: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Ralstonia eutropha H16

Site:
position = -101
score = 6.03503
sequence = TACTGTTTAAACATACAGTG

Site:
position = -121
score = 5.4495
sequence = TACTGTATAAAATCACAGCA

Gene: H16_A2281: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Cupriavidus taiwanensis

Site:
position = -98
score = 6.03503
sequence = TACTGTTTAAACATACAGTG

Site:
position = -118
score = 5.4495
sequence = TACTGTATAAAATCACAGCA

Gene: RALTA_A1825: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 4.
uvrD
*
Ralstonia solanacearum GMI1000

Site:
position = -39
score = 6.04662
sequence = TGCTGTATATTTATACAGTT

Gene: RS05321: ATP-dependent DNA helicase II
*
Ralstonia pickettii 12J

Site:
position = -40
score = 5.93239
sequence = TGCTGTATATTCATACAGTT

Gene: Rpic_4129: ATP-dependent DNA helicase II
*
Ralstonia metallidurans CH34

Site:
position = -66
score = 5.60616
sequence = GGCTGTATGGATATACAGTG

Gene: Rmet_0232: ATP-dependent DNA helicase II
*
Ralstonia eutropha JMP134

Site:
position = -6
score = 5.67101
sequence = GCCTGTATGGATATACAGTT

Gene: Reut_A0283: ATP-dependent DNA helicase II
*
Ralstonia eutropha H16

Site:
position = -68
score = 5.69864
sequence = CCCTGTATGGATATACAGTT

Gene: H16_A0305: ATP-dependent DNA helicase II
*
Cupriavidus taiwanensis

Site:
position = -62
score = 5.58274
sequence = GGCTGTATGGATATACAGTT

Gene: RALTA_A0247: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 5.
H16_A1352
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -70
score = 6.16585
sequence = TACTGTACATTCATACAGTA

Gene: Rmet_1177: Conserved hypothetical protein
*
Ralstonia eutropha JMP134

Site:
position = 125
score = 5.89529
sequence = TACTGTACATCCATACAGTA

Gene: Reut_A1285: Conserved hypothetical protein
*
Ralstonia eutropha H16

Site:
position = 41
score = 5.89529
sequence = TACTGTACATCCATACAGTA

Gene: H16_A1352: Conserved hypothetical protein
*
Cupriavidus taiwanensis

Site:
position = -33
score = 5.89529
sequence = TACTGTACATCCATACAGTA

Gene: RALTA_A1272: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 6.
PF06733
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
*
Ralstonia eutropha JMP134

Site:
position = -44
score = 6.10187
sequence = GACTGTATATTCATACAGTT

Gene: Reut_B5827: DinG family ATP-dependent helicase CPE1197
*
Ralstonia eutropha H16

Site:
position = -103
score = 6.27911
sequence = TACTGTATATTCATACAGTT

Gene: H16_B1265: DinG family ATP-dependent helicase CPE1197
*
Cupriavidus taiwanensis

Site:
position = -88
score = 6.18192
sequence = TACTGTATATTTGTACAGTT

Gene: RALTA_B1170: DinG family ATP-dependent helicase CPE1197
DinG family ATP-dependent helicase CPE1197
 
CRON 7.
dinD
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
*
Cupriavidus taiwanensis

Site:
position = -68
score = 6.28382
sequence = CACTGTATATTCATACAGTA

Gene: RALTA_A3210: DNA-damage-inducible protein, part of SOS response
DNA-damage-inducible protein, part of SOS response
 
CRON 8.
dinB
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -40
score = 6.11225
sequence = TACTGTACGTTTATACAGTA

Gene: Rmet_3545: DNA polymerase IV (EC 2.7.7.7)
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
DNA polymerase IV (EC 2.7.7.7)
 
CRON 9.
imuA
*
Ralstonia solanacearum GMI1000

Site:
position = -159
score = 6.16285
sequence = TACTGTATATCCATACAGTA

Gene: RS01909: Predicted RecA/RadA recombinase
*
Ralstonia pickettii 12J

Site:
position = -44
score = 6.43342
sequence = TACTGTATATTCATACAGTA

Gene: Rpic_4490: Predicted RecA/RadA recombinase
*
Ralstonia metallidurans CH34

Site:
position = -72
score = 6.3808
sequence = TACTGTATAAACATACAGTA

Gene: Rmet_4128: Predicted RecA/RadA recombinase
*
Ralstonia eutropha JMP134

Site:
position = 91
score = 6.34071
sequence = TACTGTATAAATATACAGTT

Gene: Reut_B4525: Predicted RecA/RadA recombinase
*
Ralstonia eutropha H16

Site:
position = -72
score = 6.34071
sequence = TACTGTATAAATATACAGTT

Gene: H16_B1060: Predicted RecA/RadA recombinase
*2
Cupriavidus taiwanensis

Site:
position = -72
score = 6.34071
sequence = TACTGTATAAATATACAGTT

Gene: RALTA_B0872: Predicted RecA/RadA recombinase

Site:
position = -41
score = 6.31778
sequence = AACTGTATAAATATACAGTA

Gene: pRALTA_0101: Predicted RecA/RadA recombinase
Predicted RecA/RadA recombinase
imuB
 
Ralstonia solanacearum GMI1000

Gene: RS01908: DNA polymerase-like protein PA0670
 
Ralstonia pickettii 12J

Gene: Rpic_4489: DNA polymerase-like protein PA0670
 
Ralstonia metallidurans CH34

Gene: Rmet_4129: DNA polymerase-like protein PA0670
 
Ralstonia eutropha JMP134

Gene: Reut_B4524: DNA polymerase-like protein PA0670
 
Ralstonia eutropha H16

Gene: H16_B1061: DNA polymerase-like protein PA0670
 2
Cupriavidus taiwanensis

Gene: RALTA_B0873: DNA polymerase-like protein PA0670

Gene: pRALTA_0100: DNA polymerase-like protein PA0670
DNA polymerase-like protein PA0670
dnaE2
 
Ralstonia solanacearum GMI1000

Gene: RSp0800: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 
Ralstonia pickettii 12J

Gene: Rpic_4488: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 
Ralstonia metallidurans CH34

Gene: Rmet_4130: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 
Ralstonia eutropha JMP134

Gene: Reut_B4523: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 
Ralstonia eutropha H16

Gene: H16_B1062: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 2
Cupriavidus taiwanensis

Gene: RALTA_B0874: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.

Gene: pRALTA_0099: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
 
CRON 10.
PF04055
 
Ralstonia solanacearum GMI1000

Gene: RS04486: DNA repair photolyase
 
Ralstonia pickettii 12J

Gene: Rpic_0799: DNA repair photolyase
*
Ralstonia metallidurans CH34

Site:
position = -48
score = 6.54765
sequence = TACTGTATATTTATACAGTA

Gene: Rmet_0742: DNA repair photolyase
 
Ralstonia eutropha JMP134

Gene: Reut_A2545: DNA repair photolyase
*
Ralstonia eutropha H16

Site:
position = -44
score = 6.47447
sequence = TACTGTATATATATACAGTG

Gene: H16_A0887: DNA repair photolyase
 
Cupriavidus taiwanensis

Gene: RALTA_A0800: DNA repair photolyase
DNA repair photolyase
 
CRON 11.
BPSS1334
*
Ralstonia solanacearum GMI1000

Site:
position = -29
score = 5.22255
sequence = CAGTGTACGTATATACAGTC

Site:
position = -44
score = 5.86716
sequence = GCCTGTATATATTTACAGTG

Gene: RS00884: Conserved hypothetical protein
*
Ralstonia pickettii 12J

Site:
position = -26
score = 5.26919
sequence = AACTGTGAATTTATACAGTG

Site:
position = -45
score = 5.97717
sequence = AACTGTATATATTCACAGTA

Gene: Rpic_4716: Conserved hypothetical protein
*
Ralstonia metallidurans CH34

Site:
position = -43
score = 5.23639
sequence = AACTGTATGGATGAACAGTC

Site:
position = -62
score = 6.28414
sequence = CACTGTATATATTTACAGTA

Gene: Rmet_1637: Conserved hypothetical protein
*
Ralstonia eutropha JMP134

Site:
position = -31
score = 5.34461
sequence = ACCTGTATGGATAAACAGTG

Site:
position = -50
score = 6.43375
sequence = TACTGTATATATTTACAGTA

Gene: Reut_B3817: Conserved hypothetical protein
*
Ralstonia eutropha H16

Site:
position = -32
score = 5.26409
sequence = ACCTGTATGGATGAACAGTA

Site:
position = -51
score = 6.43375
sequence = TACTGTATATATTTACAGTA

Gene: H16_B0943: Conserved hypothetical protein
*
Cupriavidus taiwanensis

Site:
position = -48
score = 5.1332
sequence = ACCTGTATGGATGAACAGTG

Site:
position = -67
score = 6.43375
sequence = TACTGTATATATTTACAGTA

Gene: RALTA_B0767: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 12.
uvrA
 
Ralstonia solanacearum GMI1000

Gene: RSp0994: Excinuclease ABC subunit A
 
Ralstonia pickettii 12J

Gene: Rpic_4441: Excinuclease ABC subunit A
*
Ralstonia metallidurans CH34

Site:
position = -150
score = 6.11599
sequence = CACTGTATGTTCATACAGTA

Gene: Rmet_4549: Excinuclease ABC subunit A
*
Ralstonia eutropha JMP134

Site:
position = -160
score = 5.55769
sequence = CACTGTACGGATATACAGTC

Gene: Reut_B4240: Excinuclease ABC subunit A
*
Ralstonia eutropha H16

Site:
position = -72
score = 5.74147
sequence = GACTGTATGGATGTACAGTG

Gene: H16_B1571: Excinuclease ABC subunit A
*
Cupriavidus taiwanensis

Site:
position = -71
score = 5.74147
sequence = GACTGTATGGATGTACAGTG

Gene: RALTA_B1379: Excinuclease ABC subunit A
Excinuclease ABC subunit A
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD