Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 8 4
Ralstonia pickettii 12J 8 4
Ralstonia metallidurans CH34 5 3
Ralstonia eutropha JMP134 4 2
Ralstonia eutropha H16 9 3
Cupriavidus taiwanensis 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zip
*
Ralstonia solanacearum GMI1000

Site:
position = -37
score = 5.93645
sequence = TTCTTGCAACTCTGTTGCGTTTG

Gene: RS01372: Zinc transporter, ZIP family
*
Ralstonia pickettii 12J

Site:
position = -48
score = 6.00209
sequence = TTCTTGCAACTCTGTTGCGTTTA

Gene: Rpic_2432: Zinc transporter, ZIP family
*
Ralstonia metallidurans CH34

Site:
position = -26
score = 6.42071
sequence = TTTTTGCAACATTGTTGCGTTAA

Gene: Rmet_2621: Zinc transporter, ZIP family
*
Ralstonia eutropha JMP134

Site:
position = -3
score = 6.30203
sequence = TTGTTGCAACATTGTTGCGTTTG

Gene: Reut_A0876: Zinc transporter, ZIP family
*
Ralstonia eutropha H16

Site:
position = -35
score = 6.41473
sequence = TTATTGCAACATTGTTGCGTTAG

Gene: H16_A2738: Zinc transporter, ZIP family
*
Cupriavidus taiwanensis

Site:
position = -35
score = 6.40275
sequence = TTATTGCAACATTGTTGCGTTTG

Gene: RALTA_A2241: Zinc transporter, ZIP family
Zinc transporter, ZIP family
 
CRON 2.
h16_B2121
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
*
Ralstonia eutropha H16

Site:
position = -58
score = 5.51211
sequence = CAATTGCAATTGAGTTGCGTTAA

Gene: H16_B2121: hypothetical protein
 
Cupriavidus taiwanensis
hypothetical protein
omr3
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B2120: predicted zinc-related TonB-dependent outer membrane transporter
 
Cupriavidus taiwanensis
predicted zinc-related TonB-dependent outer membrane transporter
ABC_Zn_A
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B2119: ABC-type transporter, ATPase component
 
Cupriavidus taiwanensis
predicted ABC transporter for zinc, ATPase component
ABC_Zn_P
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B2118: hypothetical membrane spanning protein
 
Cupriavidus taiwanensis
predicted ABC transporter for zinc, permease component
ABC_Zn_P2
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B2117: ABC-type transporter, permease component
 
Cupriavidus taiwanensis
predicted ABC transporter for zinc, permease component 2
 
CRON 3.
omr2
*
Ralstonia solanacearum GMI1000

Site:
position = -114
score = 6.11076
sequence = TATTTGCAACAGAGTTGCAAATT

Gene: RS00125: predicted zinc-related TonB-dependent outer membrane transporter
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B0785: predicted zinc-related TonB-dependent outer membrane transporter
 
Cupriavidus taiwanensis

Gene: RALTA_B0619: predicted zinc-related TonB-dependent outer membrane transporter
predicted zinc-related TonB-dependent outer membrane transporter
h16_B0786
 
Ralstonia solanacearum GMI1000

Gene: RS00126: hypothetical protein
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B0786: hypothetical protein
 
Cupriavidus taiwanensis

Gene: RALTA_B0620: hypothetical protein
hypothetical protein
 
CRON 4.
yciC2
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -71
score = 6.13939
sequence = TGTTTGCAACAATGTTGCATTAA

Site:
position = -99
score = 5.63588
sequence = GAAATGCAACAAGGTTGCATTTA

Gene: Rmet_1098: Putative zinc chaperone, COG0523 family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Putative zinc chaperone, COG0523 family
 
CRON 5.
tonB
*
Ralstonia solanacearum GMI1000

Site:
position = -220
score = 6.00836
sequence = TTGTCGCAACACTGTTGCATGAA

Gene: RSc1963: Component of outer membrane metal uptake system, TonB family
*
Ralstonia pickettii 12J

Site:
position = -223
score = 5.90276
sequence = TTGTCGCAACACTGTTGCAGTTG

Gene: Rpic_2116: Component of outer membrane metal uptake system, TonB family
 
Ralstonia metallidurans CH34

Gene: Rmet_2277: Component of outer membrane metal uptake system, TonB family
 
Ralstonia eutropha JMP134

Gene: Reut_A2235: Component of outer membrane metal uptake system, TonB family
 
Ralstonia eutropha H16

Gene: H16_A2532: Component of outer membrane metal uptake system, TonB family
 
Cupriavidus taiwanensis

Gene: RALTA_A2036: Component of outer membrane metal uptake system, TonB family
Component of outer membrane metal uptake system, TonB family
exbB
 
Ralstonia solanacearum GMI1000

Gene: RSc1964: Component of outer membrane metal uptake system, ExbB family
 
Ralstonia pickettii 12J

Gene: Rpic_2117: Component of outer membrane metal uptake system, ExbB family
 
Ralstonia metallidurans CH34

Gene: Rmet_2278: Component of outer membrane metal uptake system, ExbB family
 
Ralstonia eutropha JMP134

Gene: Reut_A2236: Component of outer membrane metal uptake system, ExbB family
 
Ralstonia eutropha H16

Gene: H16_A2533: Component of outer membrane metal uptake system, ExbB family
 
Cupriavidus taiwanensis

Gene: RALTA_A2037: Component of outer membrane metal uptake system, ExbB family
Component of outer membrane metal uptake system, ExbB family
exbD
 
Ralstonia solanacearum GMI1000

Gene: RSc1965: Component of outer membrane metal uptake system, ExbD family
 
Ralstonia pickettii 12J

Gene: Rpic_2118: Component of outer membrane metal uptake system, ExbD family
 
Ralstonia metallidurans CH34

Gene: Rmet_2279: Component of outer membrane metal uptake system, ExbD family
 
Ralstonia eutropha JMP134

Gene: Reut_A2237: Component of outer membrane metal uptake system, ExbD family
 
Ralstonia eutropha H16

Gene: H16_A2534: Component of outer membrane metal uptake system, ExbD family
 
Cupriavidus taiwanensis

Gene: RALTA_A2038: Component of outer membrane metal uptake system, ExbD family
Component of outer membrane metal uptake system, ExbD family
 
CRON 6.
yciC
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_3703: Putative zinc chaperone, COG0523 family
*
Ralstonia metallidurans CH34

Site:
position = -34
score = 6.1063
sequence = CAGTCGCAACTTTGTTGCATCAA

Gene: Rmet_0125: Putative zinc chaperone, COG0523 family
*
Ralstonia eutropha JMP134

Site:
position = -66
score = 6.31073
sequence = CAGTCGCAACTTTGTTGCAATAA

Gene: Reut_A0161: Putative zinc chaperone, COG0523 family
*
Ralstonia eutropha H16

Site:
position = -75
score = 5.96793
sequence = AATTCGCAACCTTGTTGCAACAA

Gene: H16_A0193: Putative zinc chaperone, COG0523 family
*
Cupriavidus taiwanensis

Site:
position = -76
score = 5.9023
sequence = AATTCGCAACCTTGTTGCAACAG

Gene: RALTA_A0136: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
h16_A0192
*
Ralstonia solanacearum GMI1000

Site:
position = -95
score = 5.74979
sequence = AATTCGCAACTTAGTTGCATTGG

Gene: RS04852: hypothetical transmembrane protein
*
Ralstonia pickettii 12J

Site:
position = -31
score = 5.74979
sequence = AATTCGCAACTTAGTTGCATTGG

Gene: Rpic_0521: hypothetical transmembrane protein
 
Ralstonia metallidurans CH34

Gene: Rmet_0124: hypothetical transmembrane protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0160: hypothetical transmembrane protein
 
Ralstonia eutropha H16

Gene: H16_A0192: hypothetical transmembrane protein
 
Cupriavidus taiwanensis

Gene: RALTA_A0135: hypothetical transmembrane protein
hypothetical transmembrane protein
omr
 
Ralstonia solanacearum GMI1000

Gene: RS04851: predicted zinc-related TonB-dependent outer membrane transporter
 
Ralstonia pickettii 12J

Gene: Rpic_0522: predicted zinc-related TonB-dependent outer membrane transporter
 
Ralstonia metallidurans CH34

Gene: Rmet_0123: predicted zinc-related TonB-dependent outer membrane transporter
 
Ralstonia eutropha JMP134

Gene: Reut_A0159: predicted zinc-related TonB-dependent outer membrane transporter
 
Ralstonia eutropha H16

Gene: H16_A0191: predicted zinc-related TonB-dependent outer membrane transporter
 
Cupriavidus taiwanensis

Gene: RALTA_A0134: predicted zinc-related TonB-dependent outer membrane transporter
predicted zinc-related TonB-dependent outer membrane transporter
zur
 
Ralstonia solanacearum GMI1000
*
Ralstonia pickettii 12J

Site:
position = -50
score = 5.18457
sequence = CAATTGCAACTCAATTGCAGCAA

Gene: Rpic_3702: Zinc uptake regulator, Fur family
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Zinc uptake regulator, Fur family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD