Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 1 1
Ralstonia pickettii 12J 3 2
Ralstonia metallidurans CH34 4 2
Ralstonia eutropha JMP134 3 1
Ralstonia eutropha H16 3 1
Cupriavidus taiwanensis 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nifQ
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -73
score = 5.20213
sequence = GGCGTTATATACGTGGTTATATTGCGAT

Gene: Rmet_4126: iron-molybdenum cofactor biosynthesis protein NifQ
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis

Gene: pRALTA_0376: iron-molybdenum cofactor biosynthesis protein NifQ
iron-molybdenum cofactor biosynthesis protein NifQ
 
CRON 2.
modA
*
Ralstonia solanacearum GMI1000

Site:
position = -57
score = 4.81944
sequence = GGCGTTATATCGGCCCGTATATTACGAT

Gene: RSp0106: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Ralstonia pickettii 12J

Site:
position = -58
score = 4.35944
sequence = ACCGTTATATCGGCTCGTATATTACGCC

Gene: Rpic_3851: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Ralstonia metallidurans CH34

Site:
position = -63
score = 4.84267
sequence = TGCGCTATATACCCGCTTATATTGCGCG

Gene: Rmet_0571: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Ralstonia eutropha JMP134

Site:
position = -82
score = 4.8074
sequence = CTCGCTATATACAGCCTTATATTGCGCC

Gene: Reut_A0634: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Ralstonia eutropha H16

Site:
position = -89
score = 5.00979
sequence = AGCGCTATATACAGACGTATATTGCGCG

Gene: H16_A0677: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Cupriavidus taiwanensis

Site:
position = -97
score = 4.69138
sequence = CGCGCTATATACAGACGTATATTGCGCC

Gene: RALTA_A0633: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Ralstonia solanacearum GMI1000

Gene: RS05467: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
*
Ralstonia pickettii 12J

Site:
position = -119
score = 4.21705
sequence = GGCGTTATATCCAACCCTATATTTCGGA

Gene: Rpic_4222: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Ralstonia metallidurans CH34

Gene: Rmet_0570: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Ralstonia eutropha JMP134

Gene: Reut_A0633: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Ralstonia eutropha H16

Gene: H16_A0676: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Cupriavidus taiwanensis

Gene: RALTA_A0632: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Ralstonia solanacearum GMI1000

Gene: RS05462: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Ralstonia pickettii 12J

Gene: Rpic_4221: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Ralstonia metallidurans CH34

Gene: Rmet_0569: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Ralstonia eutropha JMP134

Gene: Reut_A0632: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Ralstonia eutropha H16

Gene: H16_A0675: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Cupriavidus taiwanensis

Gene: RALTA_A0631: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD