Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 9 1
Ralstonia pickettii 12J 9 1
Ralstonia metallidurans CH34 8 1
Ralstonia eutropha JMP134 9 1
Ralstonia eutropha H16 9 1
Cupriavidus taiwanensis 9 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Ralstonia solanacearum GMI1000

Site:
position = -36
score = 6.5205
sequence = ATACTTGAGCAAAACGATCAGGTAT

Site:
position = -65
score = 6.2931
sequence = TTAGTTGACTGATTTTGTCGGGTTC

Gene: RS04257: Iron-sulfur cluster regulator IscR
*
Ralstonia pickettii 12J

Site:
position = -66
score = 6.26086
sequence = TTAGTTGACCGATTTTGTCGGGTTC

Site:
position = -37
score = 6.5205
sequence = ATACTTGAGCAAAACGATCAGGTAT

Gene: Rpic_0883: Iron-sulfur cluster regulator IscR
*
Ralstonia metallidurans CH34

Site:
position = -40
score = 6.18639
sequence = ATACTCGACCGAAATCCTCAAGTAT

Site:
position = -69
score = 5.90057
sequence = GTACTTGACTGATTTAGTCGGAAAA

Gene: Rmet_1024: Iron-sulfur cluster regulator IscR
*
Ralstonia eutropha JMP134

Site:
position = -37
score = 6.83888
sequence = ATACTTGACGGAAACGATCAAGTAT

Site:
position = -66
score = 6.92236
sequence = GTAGTTGACTGAAATAGTCGGGTAC

Gene: Reut_A1057: Iron-sulfur cluster regulator IscR
*
Ralstonia eutropha H16

Site:
position = -51
score = 6.83888
sequence = ATACTTGACGGAAACGATCAAGTAT

Site:
position = -80
score = 6.87249
sequence = GTAGTTGACTGAATTAGTCGGGTAC

Gene: H16_A1157: Iron-sulfur cluster regulator IscR
*
Cupriavidus taiwanensis

Site:
position = -92
score = 6.87249
sequence = GTAGTTGACTGAATTAGTCGGGTAC

Site:
position = -63
score = 6.83888
sequence = ATACTTGACGGAAACGATCAAGTAT

Gene: RALTA_A1138: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Ralstonia solanacearum GMI1000

Gene: RSc1019: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Ralstonia pickettii 12J

Gene: Rpic_0884: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Ralstonia metallidurans CH34

Gene: Rmet_1025: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Ralstonia eutropha JMP134

Gene: Reut_A1058: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Ralstonia eutropha H16

Gene: H16_A1158: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Cupriavidus taiwanensis

Gene: RALTA_A1139: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Ralstonia solanacearum GMI1000

Gene: RSc1020: Iron-sulfur cluster assembly scaffold protein IscU
 
Ralstonia pickettii 12J

Gene: Rpic_0885: Iron-sulfur cluster assembly scaffold protein IscU
 
Ralstonia metallidurans CH34

Gene: Rmet_1026: Iron-sulfur cluster assembly scaffold protein IscU
 
Ralstonia eutropha JMP134

Gene: Reut_A1059: Iron-sulfur cluster assembly scaffold protein IscU
 
Ralstonia eutropha H16

Gene: H16_A1159: Iron-sulfur cluster assembly scaffold protein IscU
 
Cupriavidus taiwanensis

Gene: RALTA_A1140: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Ralstonia solanacearum GMI1000

Gene: RS04236: Iron binding protein IscA for iron-sulfur cluster assembly
 
Ralstonia pickettii 12J

Gene: Rpic_0886: Iron binding protein IscA for iron-sulfur cluster assembly
 
Ralstonia metallidurans CH34

Gene: Rmet_1027: Iron binding protein IscA for iron-sulfur cluster assembly
 
Ralstonia eutropha JMP134

Gene: Reut_A1060: Iron binding protein IscA for iron-sulfur cluster assembly
 
Ralstonia eutropha H16

Gene: H16_A1160: Iron binding protein IscA for iron-sulfur cluster assembly
 
Cupriavidus taiwanensis

Gene: RALTA_A1141: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
RSc1022
 
Ralstonia solanacearum GMI1000

Gene: RS04245: hypothetical protein
 
Ralstonia pickettii 12J

Gene: Rpic_0887: hypothetical protein
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134

Gene: Reut_A1061: hypothetical protein
 
Ralstonia eutropha H16

Gene: H16_A1161: hypothetical protein
 
Cupriavidus taiwanensis

Gene: RALTA_A1142: hypothetical protein
hypothetical protein
hscB
 
Ralstonia solanacearum GMI1000

Gene: RSc1023: Chaperone protein HscB
 
Ralstonia pickettii 12J

Gene: Rpic_0888: Chaperone protein HscB
 
Ralstonia metallidurans CH34

Gene: Rmet_1028: Chaperone protein HscB
 
Ralstonia eutropha JMP134

Gene: Reut_A1062: Chaperone protein HscB
 
Ralstonia eutropha H16

Gene: H16_A1162: Chaperone protein HscB
 
Cupriavidus taiwanensis

Gene: RALTA_A1143: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Ralstonia solanacearum GMI1000

Gene: RSc1024: Chaperone protein HscA
 
Ralstonia pickettii 12J

Gene: Rpic_0889: Chaperone protein HscA
 
Ralstonia metallidurans CH34

Gene: Rmet_1029: Chaperone protein HscA
 
Ralstonia eutropha JMP134

Gene: Reut_A1063: Chaperone protein HscA
 
Ralstonia eutropha H16

Gene: H16_A1163: Chaperone protein HscA
 
Cupriavidus taiwanensis

Gene: RALTA_A1144: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Ralstonia solanacearum GMI1000

Gene: RSc1025: ferredoxin, 2Fe-2S type, ISC system
 
Ralstonia pickettii 12J

Gene: Rpic_0890: ferredoxin, 2Fe-2S type, ISC system
 
Ralstonia metallidurans CH34

Gene: Rmet_1030: ferredoxin, 2Fe-2S type, ISC system
 
Ralstonia eutropha JMP134

Gene: Reut_A1064: ferredoxin, 2Fe-2S type, ISC system
 
Ralstonia eutropha H16

Gene: H16_A1164: ferredoxin, 2Fe-2S type, ISC system
 
Cupriavidus taiwanensis

Gene: RALTA_A1145: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
yhfJ
 
Ralstonia solanacearum GMI1000

Gene: RS04227: putative Fe-S cluster assembly protein
 
Ralstonia pickettii 12J

Gene: Rpic_0891: putative Fe-S cluster assembly protein
 
Ralstonia metallidurans CH34

Gene: Rmet_1031: putative Fe-S cluster assembly protein
 
Ralstonia eutropha JMP134

Gene: Reut_A1065: putative Fe-S cluster assembly protein
 
Ralstonia eutropha H16

Gene: H16_A1165: putative Fe-S cluster assembly protein
 
Cupriavidus taiwanensis

Gene: RALTA_A1146: putative Fe-S cluster assembly protein
putative Fe-S cluster assembly protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD