Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides uniformis ATCC 8492

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides uniformis ATCC 8492
Orthologous TF(s) BACUNI_01378
Regulated genes 4
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides uniformis ATCC 8492
Locus tag Position Score Sequence
Position: -38
Score: 6.6
Sequence: AAAAATGTAATAATTACAAGTTT
Locus tag: BACUNI_01378
BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides cellulosilyticus DSM 14838 BACCELL_05678 -36 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides dorei DSM 17855 BACDOR_03683 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides eggerthii DSM 20697 BACEGG_01512 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides fragilis NCTC 9343 BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Bacteroides stercoris ATCC 43183 BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides uniformis ATCC 8492 BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Bacteroides vulgatus ATCC 8482 BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides coprophilus DSM 18228 BACCOPRO_01403 -33 6.1 AAAATTGTAATAGTTACAGAATT
Position: -45
Score: 6
Sequence: TAATTTGTAATCTTTACAATAAT
Locus tag: BACUNI_01674
BACUNI_01674 -45 6 TAATTTGTAATCTTTACAATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acn
Ortholog function: Aconitate hydratase (EC 4.2.1.3)
Bacteroides cellulosilyticus DSM 14838 BACCELL_00993 -47 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides dorei DSM 17855 BACDOR_03102 -25 5.9 AAAACTGTAATAATTATAAATTG
Bacteroides eggerthii DSM 20697 BACEGG_00294 -48 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides stercoris ATCC 43183 BACSTE_03162 -45 6.1 TAATTTGTAATATTTACAATATT
Bacteroides uniformis ATCC 8492 BACUNI_01674 -45 6 TAATTTGTAATCTTTACAATAAT
Bacteroides vulgatus ATCC 8482 BVU_1959 -19 5.6 AAAACTGTAATAATTATAAATGG
Position: -35
Score: 5
Sequence: TAATTTGTTATGTATACATATAA
Locus tag: BACUNI_04341
BACUNI_04341 -35 5 TAATTTGTTATGTATACATATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: tpx
Ortholog function: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Bacteroides dorei DSM 17855 BACDOR_00877 -44 5.7 AAATTTGTTATCATTACAGTATC
Bacteroides uniformis ATCC 8492 BACUNI_04341 -35 5 TAATTTGTTATGTATACATATAA
Bacteroides vulgatus ATCC 8482 BVU_3944 -44 5.7 AAATTTGTTATCATTACAGTATC
Bacteroides coprophilus DSM 18228 BACCOPRO_01040 -56 6.3 ATATTTGTAATTATTACATATCT
Position: -36
Score: 5.8
Sequence: ACTTTTGTAATGATTTCAATTTA
Locus tag: BACUNI_04391
BACUNI_04391 -36 5.8 ACTTTTGTAATGATTTCAATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ftn
Ortholog function: Ferritin
Bacteroides cellulosilyticus DSM 14838 BACCELL_00354 -40 5.8 ACTTTTGTAATGATTTCAAATTA
Bacteroides eggerthii DSM 20697 BACEGG_01676 -39 6.3 ATATTTGTAATCATTTCAATTTA
Bacteroides stercoris ATCC 43183 BACSTE_00720 -39 6.3 ATATTTGTAATCATTTCAATTTA
Bacteroides uniformis ATCC 8492 BACUNI_04391 -36 5.8 ACTTTTGTAATGATTTCAATTTA